Mutagenetix > Incidental Mutation

Incidental Mutation 'R4613:Cdh22'

350936

Institutional Source

Beutler Lab

Gene Symbol

Cdh22

Ensembl Gene

ENSMUSG00000053166

Gene Name

cadherin 22

Synonyms

PB-cadherin

MMRRC Submission

041824-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R4613 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

165111507-165234853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 165143656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 337 (I337L)

Ref Sequence

ENSEMBL: ENSMUSP00000120785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]

AlphaFold

Q9WTP5

Predicted Effect

probably benign
Transcript: ENSMUST00000065438
AA Change: I337L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: I337L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART
CA	413	494	2.27e-23	SMART
CA	517	604	4.52e-9	SMART
transmembrane domain	622	644	N/A	INTRINSIC
Pfam:Cadherin_C	647	803	4.3e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138643
AA Change: I337L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166
AA Change: I337L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
CA	82	163	2.19e-16	SMART
CA	187	272	3.11e-30	SMART
CA	296	390	4.88e-14	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9830107B12Rik	A	T	17: 48,128,557	L130I	probably benign	Het
Abca9	A	G	11: 110,144,784	V670A	probably benign	Het
Adad1	A	G	3: 37,092,033	N517D	probably damaging	Het
Ankle2	T	C	5: 110,231,379	L48P	probably benign	Het
Aoc3	A	T	11: 101,337,659		probably benign	Het
Areg	A	G	5: 91,143,504	K102R	probably benign	Het
Bmp1	T	C	14: 70,508,523	T167A	probably damaging	Het
C4b	C	T	17: 34,734,551	G986D	probably benign	Het
Caml	G	T	13: 55,625,142	G200C	probably damaging	Het
Ccdc40	A	C	11: 119,231,532	R53S	probably benign	Het
Col12a1	A	T	9: 79,647,601	V2065D	probably benign	Het
Copg2	A	G	6: 30,811,596	S591P	probably benign	Het
Cyp2d34	G	A	15: 82,616,325	P438S	probably damaging	Het
Dchs1	T	C	7: 105,772,724	D163G	probably damaging	Het
Depdc1b	T	C	13: 108,363,643	V230A	probably damaging	Het
Depdc5	T	A	5: 32,975,446	L1300H	probably damaging	Het
Dnah10	G	T	5: 124,762,869		probably null	Het
Dsc2	A	T	18: 20,041,819	D466E	probably damaging	Het
Dthd1	A	G	5: 62,827,068	D372G	probably damaging	Het
Eogt	G	T	6: 97,134,304	Q199K	probably benign	Het
Epha6	C	A	16: 59,666,597	R1029L	possibly damaging	Het
Eppin	C	A	2: 164,589,323	E128*	probably null	Het
Fam102b	A	T	3: 109,027,255	F23I	probably benign	Het
Fam160b1	C	A	19: 57,371,187	P53Q	probably damaging	Het
Fgf20	T	C	8: 40,286,611	R33G	probably benign	Het
Fgg	A	G	3: 83,010,090	N142S	probably damaging	Het
Gba	C	T	3: 89,208,644		probably null	Het
Gli2	A	G	1: 118,837,511	V970A	probably damaging	Het
Gramd1b	A	T	9: 40,307,993	V508D	probably damaging	Het
Gucy2c	T	A	6: 136,708,321	D898V	probably damaging	Het
Kcnj15	T	C	16: 95,295,794	Y92H	probably damaging	Het
L3mbtl3	A	T	10: 26,282,795	S652T	unknown	Het
Ldb2	G	T	5: 44,476,551	Q326K	probably benign	Het
Lipi	C	A	16: 75,560,801	R292L	probably benign	Het
Lrrc36	G	A	8: 105,449,614	V207I	possibly damaging	Het
Lyplal1	C	T	1: 186,088,752	G166D	probably benign	Het
Map1b	A	T	13: 99,430,302	Y1970*	probably null	Het
Map2	A	G	1: 66,425,469	N287D	probably damaging	Het
Map3k11	A	T	19: 5,697,470	Q578L	probably benign	Het
Map3k11	G	T	19: 5,697,471	Q578H	probably damaging	Het
Map4k4	G	A	1: 40,017,191	S1012N	probably benign	Het
Mapk13	A	T	17: 28,769,452	N15Y	probably damaging	Het
Mapk15	G	A	15: 75,995,910	A125T	probably damaging	Het
Mrgprb1	C	A	7: 48,447,708	R152L	possibly damaging	Het
Muc5ac	T	G	7: 141,791,103	Y104D	possibly damaging	Het
Myo1h	A	G	5: 114,348,379	N566S	possibly damaging	Het
Myo1h	C	A	5: 114,351,676	H647Q	probably benign	Het
Neo1	A	G	9: 58,889,041	I1201T	possibly damaging	Het
Nlgn1	T	C	3: 25,436,022	T514A	probably benign	Het
Olfr120	A	G	17: 37,726,696	Y224C	probably damaging	Het
Olfr533	A	T	7: 140,467,068	Y289F	probably damaging	Het
Olfr8	A	G	10: 78,956,065	N287D	probably damaging	Het
Olfr985	T	A	9: 40,127,722	K80*	probably null	Het
Orc2	A	T	1: 58,500,309	L57*	probably null	Het
Otoa	G	A	7: 121,145,568	V850M	probably damaging	Het
Pcnx3	T	C	19: 5,667,219	T1579A	possibly damaging	Het
Pde5a	A	T	3: 122,823,093	Y564F	probably damaging	Het
Pdxk	A	C	10: 78,447,919	I147S	probably damaging	Het
Pfdn5	A	G	15: 102,328,752	D108G	probably benign	Het
Pink1	T	C	4: 138,317,310	D342G	probably damaging	Het
Prkacb	A	T	3: 146,737,998	V336E	probably damaging	Het
Ptpro	C	A	6: 137,416,836	S13*	probably null	Het
Rfng	A	G	11: 120,782,650	L215P	probably damaging	Het
Rpn2	T	C	2: 157,302,425	F336L	possibly damaging	Het
Sacs	A	G	14: 61,211,797		probably null	Het
Sirpb1a	T	A	3: 15,417,037	Y77F	probably benign	Het
Skiv2l2	C	A	13: 112,921,739	E53*	probably null	Het
Slc30a8	A	G	15: 52,333,575	D294G	probably benign	Het
Sox13	T	C	1: 133,388,934	I212V	probably benign	Het
Srebf2	T	A	15: 82,185,348	I657N	possibly damaging	Het
Srsf6	C	A	2: 162,933,709	T146K	probably benign	Het
Strn4	T	C	7: 16,824,163	V162A	possibly damaging	Het
Sulf2	T	C	2: 166,132,605	D53G	probably damaging	Het
Tbc1d8	T	A	1: 39,372,708	I1016F	probably damaging	Het
Tfrc	G	T	16: 32,618,657	A278S	probably damaging	Het
Tnrc6a	T	G	7: 123,184,289		probably null	Het
Vmn1r83	T	C	7: 12,321,768	I121V	probably benign	Het
Vps13d	T	C	4: 145,131,655	S2200G	possibly damaging	Het
Washc2	T	A	6: 116,229,269	D397E	probably damaging	Het
Wipf3	T	C	6: 54,485,555	L250P	probably damaging	Het
Xirp1	A	G	9: 120,019,682	F45S	probably damaging	Het
Xpo5	A	G	17: 46,236,963	T910A	probably benign	Het
Zfp235	T	C	7: 24,141,676	Y507H	probably damaging	Het

Other mutations in Cdh22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cdh22	APN	2	165112601	missense	possibly damaging	0.54
IGL01868:Cdh22	APN	2	165157358	missense	probably damaging	0.99
IGL01932:Cdh22	APN	2	165170808	missense	probably benign	0.05
IGL02268:Cdh22	APN	2	165123719	splice site	probably benign
IGL02455:Cdh22	APN	2	165142255	missense	possibly damaging	0.46
IGL03231:Cdh22	APN	2	165116206	missense	probably benign	0.16
IGL03264:Cdh22	APN	2	165116173	missense	probably benign	0.21
IGL03014:Cdh22	UTSW	2	165112411	nonsense	probably null
R0712:Cdh22	UTSW	2	165170656	missense	probably damaging	1.00
R0865:Cdh22	UTSW	2	165181056	missense	probably damaging	0.98
R1192:Cdh22	UTSW	2	165135283	missense	probably damaging	1.00
R1700:Cdh22	UTSW	2	165170796	missense	probably damaging	1.00
R1844:Cdh22	UTSW	2	165143694	missense	probably damaging	1.00
R2005:Cdh22	UTSW	2	165180923	missense	probably damaging	1.00
R2137:Cdh22	UTSW	2	165116394	splice site	probably benign
R2270:Cdh22	UTSW	2	165143847	splice site	probably null
R2271:Cdh22	UTSW	2	165143847	splice site	probably null
R2272:Cdh22	UTSW	2	165143847	splice site	probably null
R4021:Cdh22	UTSW	2	165143673	missense	possibly damaging	0.81
R4022:Cdh22	UTSW	2	165157253	missense	probably benign	0.14
R4625:Cdh22	UTSW	2	165112606	missense	probably damaging	1.00
R5038:Cdh22	UTSW	2	165142277	missense	probably benign	0.16
R5057:Cdh22	UTSW	2	165116143	missense	probably damaging	0.98
R5649:Cdh22	UTSW	2	165116280	missense	probably damaging	1.00
R6175:Cdh22	UTSW	2	165146630	missense	probably damaging	0.98
R6297:Cdh22	UTSW	2	165143644	missense	possibly damaging	0.86
R6445:Cdh22	UTSW	2	165170692	missense	probably damaging	0.97
R7294:Cdh22	UTSW	2	165142093	missense	possibly damaging	0.94
R7310:Cdh22	UTSW	2	165112294	nonsense	probably null
R7595:Cdh22	UTSW	2	165112463	missense	probably benign	0.00
R7601:Cdh22	UTSW	2	165112546	missense	probably damaging	1.00
R8047:Cdh22	UTSW	2	165170767	missense	probably damaging	1.00
R8308:Cdh22	UTSW	2	165112178	missense	probably damaging	0.99
R8480:Cdh22	UTSW	2	165146726	missense	probably benign
R8526:Cdh22	UTSW	2	165112258	missense	probably damaging	1.00
R8771:Cdh22	UTSW	2	165146769	missense	possibly damaging	0.94
R8927:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R8928:Cdh22	UTSW	2	165123584	missense	possibly damaging	0.58
R9158:Cdh22	UTSW	2	165170707	missense	probably damaging	1.00
R9433:Cdh22	UTSW	2	165112409	missense	probably benign	0.32
R9498:Cdh22	UTSW	2	165112570	missense	probably damaging	1.00
R9638:Cdh22	UTSW	2	165146767	missense	probably damaging	0.97
R9657:Cdh22	UTSW	2	165123795	missense	probably benign	0.01
Z1088:Cdh22	UTSW	2	165112430	missense	probably benign	0.01
Z1176:Cdh22	UTSW	2	165116184	missense	probably damaging	1.00
Z1177:Cdh22	UTSW	2	165146680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCTCGAAAACCCTGAGTG -3'
(R):5'- CCACAGAGATGTACCAGTTCAG -3'

Sequencing Primer
(F):5'- CTCGAAAACCCTGAGTGGTTACG -3'
(R):5'- TGTACCAGTTCAGCATACAGGAGTC -3'

Posted On

2015-10-08