Incidental Mutation 'R4613:Vps13d'
ID 350947
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Name vacuolar protein sorting 13D
Synonyms
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 144699192-144921575 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144858225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 2200 (S2200G)
Ref Sequence ENSEMBL: ENSMUSP00000043240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020441
AA Change: S2194G

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: S2194G

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000036579
AA Change: S2200G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: S2200G

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185113
AA Change: S1021G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 144,895,110 (GRCm39) missense probably damaging 0.98
IGL00484:Vps13d APN 4 144,853,145 (GRCm39) missense probably benign 0.04
IGL00591:Vps13d APN 4 144,917,129 (GRCm39) missense possibly damaging 0.95
IGL00816:Vps13d APN 4 144,882,564 (GRCm39) missense probably benign 0.00
IGL00835:Vps13d APN 4 144,887,222 (GRCm39) missense probably damaging 0.97
IGL00847:Vps13d APN 4 144,811,978 (GRCm39) missense probably benign 0.26
IGL01084:Vps13d APN 4 144,881,525 (GRCm39) missense probably benign 0.00
IGL01116:Vps13d APN 4 144,699,320 (GRCm39) unclassified probably benign
IGL01150:Vps13d APN 4 144,875,845 (GRCm39) missense probably benign
IGL01329:Vps13d APN 4 144,882,776 (GRCm39) missense possibly damaging 0.69
IGL01338:Vps13d APN 4 144,814,892 (GRCm39) missense probably damaging 1.00
IGL01583:Vps13d APN 4 144,771,658 (GRCm39) missense probably damaging 1.00
IGL01598:Vps13d APN 4 144,743,471 (GRCm39) missense probably benign 0.21
IGL01620:Vps13d APN 4 144,821,437 (GRCm39) missense possibly damaging 0.70
IGL01636:Vps13d APN 4 144,801,618 (GRCm39) missense probably damaging 1.00
IGL01723:Vps13d APN 4 144,899,715 (GRCm39) missense possibly damaging 0.84
IGL01895:Vps13d APN 4 144,882,836 (GRCm39) missense possibly damaging 0.57
IGL01981:Vps13d APN 4 144,813,317 (GRCm39) missense probably damaging 0.99
IGL02192:Vps13d APN 4 144,875,428 (GRCm39) missense probably benign 0.02
IGL02197:Vps13d APN 4 144,854,879 (GRCm39) missense probably benign 0.01
IGL02209:Vps13d APN 4 144,882,671 (GRCm39) missense probably damaging 0.97
IGL02219:Vps13d APN 4 144,894,716 (GRCm39) missense probably benign 0.00
IGL02377:Vps13d APN 4 144,882,934 (GRCm39) missense probably damaging 1.00
IGL02404:Vps13d APN 4 144,875,305 (GRCm39) missense probably damaging 1.00
IGL02552:Vps13d APN 4 144,899,707 (GRCm39) missense possibly damaging 0.46
IGL02651:Vps13d APN 4 144,891,129 (GRCm39) missense probably benign 0.02
IGL02708:Vps13d APN 4 144,854,850 (GRCm39) missense probably benign 0.12
IGL02811:Vps13d APN 4 144,858,335 (GRCm39) missense possibly damaging 0.55
IGL02821:Vps13d APN 4 144,875,332 (GRCm39) missense probably damaging 0.98
IGL02838:Vps13d APN 4 144,801,595 (GRCm39) missense probably benign 0.31
IGL02968:Vps13d APN 4 144,849,068 (GRCm39) missense probably benign 0.32
IGL03176:Vps13d APN 4 144,801,533 (GRCm39) missense probably benign 0.16
IGL03352:Vps13d APN 4 144,894,072 (GRCm39) missense possibly damaging 0.49
IGL03374:Vps13d APN 4 144,835,145 (GRCm39) missense possibly damaging 0.70
IGL03375:Vps13d APN 4 144,818,517 (GRCm39) missense probably damaging 1.00
IGL03383:Vps13d APN 4 144,894,889 (GRCm39) critical splice acceptor site probably null
IGL03411:Vps13d APN 4 144,875,894 (GRCm39) missense probably damaging 1.00
broken UTSW 4 144,813,305 (GRCm39) missense
demotion UTSW 4 144,865,183 (GRCm39) missense
BB008:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
BB018:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
PIT4283001:Vps13d UTSW 4 144,835,158 (GRCm39) missense
PIT4434001:Vps13d UTSW 4 144,881,817 (GRCm39) missense
R0069:Vps13d UTSW 4 144,789,133 (GRCm39) missense probably benign 0.09
R0069:Vps13d UTSW 4 144,789,133 (GRCm39) missense probably benign 0.09
R0076:Vps13d UTSW 4 144,891,264 (GRCm39) splice site probably benign
R0211:Vps13d UTSW 4 144,841,348 (GRCm39) missense probably benign 0.08
R0219:Vps13d UTSW 4 144,832,479 (GRCm39) missense probably benign 0.01
R0284:Vps13d UTSW 4 144,871,372 (GRCm39) missense probably benign 0.01
R0345:Vps13d UTSW 4 144,844,195 (GRCm39) missense possibly damaging 0.81
R0400:Vps13d UTSW 4 144,792,397 (GRCm39) missense probably benign 0.00
R0417:Vps13d UTSW 4 144,703,130 (GRCm39) missense probably benign 0.19
R0538:Vps13d UTSW 4 144,771,665 (GRCm39) missense probably damaging 1.00
R0560:Vps13d UTSW 4 144,780,760 (GRCm39) missense probably damaging 1.00
R0627:Vps13d UTSW 4 144,813,754 (GRCm39) missense probably damaging 1.00
R0707:Vps13d UTSW 4 144,882,502 (GRCm39) missense probably damaging 1.00
R0782:Vps13d UTSW 4 144,853,195 (GRCm39) splice site probably benign
R0925:Vps13d UTSW 4 144,883,121 (GRCm39) missense probably damaging 1.00
R0993:Vps13d UTSW 4 144,844,262 (GRCm39) nonsense probably null
R1135:Vps13d UTSW 4 144,882,159 (GRCm39) missense probably benign 0.01
R1165:Vps13d UTSW 4 144,853,041 (GRCm39) missense probably benign
R1263:Vps13d UTSW 4 144,896,918 (GRCm39) missense probably benign 0.01
R1397:Vps13d UTSW 4 144,867,904 (GRCm39) missense probably damaging 1.00
R1398:Vps13d UTSW 4 144,826,553 (GRCm39) missense probably null
R1521:Vps13d UTSW 4 144,832,431 (GRCm39) missense probably benign 0.00
R1522:Vps13d UTSW 4 144,824,742 (GRCm39) splice site probably null
R1725:Vps13d UTSW 4 144,869,830 (GRCm39) missense possibly damaging 0.90
R1759:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R1826:Vps13d UTSW 4 144,881,573 (GRCm39) missense probably damaging 0.96
R1900:Vps13d UTSW 4 144,853,176 (GRCm39) missense probably benign 0.23
R1943:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R1955:Vps13d UTSW 4 144,882,713 (GRCm39) missense probably damaging 1.00
R2008:Vps13d UTSW 4 144,881,813 (GRCm39) missense probably benign 0.00
R2013:Vps13d UTSW 4 144,835,078 (GRCm39) missense probably damaging 0.99
R2014:Vps13d UTSW 4 144,835,078 (GRCm39) missense probably damaging 0.99
R2038:Vps13d UTSW 4 144,907,685 (GRCm39) critical splice donor site probably null
R2108:Vps13d UTSW 4 144,801,617 (GRCm39) missense probably damaging 0.99
R2130:Vps13d UTSW 4 144,882,671 (GRCm39) missense probably benign 0.17
R2134:Vps13d UTSW 4 144,874,909 (GRCm39) missense probably benign 0.00
R2168:Vps13d UTSW 4 144,813,893 (GRCm39) splice site probably benign
R2220:Vps13d UTSW 4 144,904,890 (GRCm39) missense probably damaging 1.00
R2240:Vps13d UTSW 4 144,837,465 (GRCm39) missense possibly damaging 0.70
R2332:Vps13d UTSW 4 144,875,256 (GRCm39) missense probably benign
R2357:Vps13d UTSW 4 144,801,547 (GRCm39) frame shift probably null
R2365:Vps13d UTSW 4 144,813,894 (GRCm39) splice site probably benign
R2571:Vps13d UTSW 4 144,875,706 (GRCm39) missense probably benign 0.20
R3149:Vps13d UTSW 4 144,853,147 (GRCm39) missense possibly damaging 0.70
R3150:Vps13d UTSW 4 144,813,360 (GRCm39) missense probably damaging 0.98
R3547:Vps13d UTSW 4 144,801,545 (GRCm39) missense probably damaging 0.99
R3716:Vps13d UTSW 4 144,802,296 (GRCm39) missense probably damaging 1.00
R3718:Vps13d UTSW 4 144,802,296 (GRCm39) missense probably damaging 1.00
R3725:Vps13d UTSW 4 144,842,218 (GRCm39) splice site probably benign
R3794:Vps13d UTSW 4 144,812,007 (GRCm39) splice site probably benign
R3875:Vps13d UTSW 4 144,917,114 (GRCm39) missense probably damaging 1.00
R3948:Vps13d UTSW 4 144,867,910 (GRCm39) missense probably damaging 1.00
R3953:Vps13d UTSW 4 144,875,450 (GRCm39) missense probably damaging 1.00
R4021:Vps13d UTSW 4 144,801,631 (GRCm39) missense possibly damaging 0.90
R4323:Vps13d UTSW 4 144,879,348 (GRCm39) missense probably benign 0.28
R4346:Vps13d UTSW 4 144,799,099 (GRCm39) intron probably benign
R4509:Vps13d UTSW 4 144,789,172 (GRCm39) missense probably damaging 1.00
R4657:Vps13d UTSW 4 144,801,412 (GRCm39) missense probably damaging 1.00
R4680:Vps13d UTSW 4 144,835,080 (GRCm39) missense possibly damaging 0.94
R4688:Vps13d UTSW 4 144,904,782 (GRCm39) missense probably benign
R4797:Vps13d UTSW 4 144,780,725 (GRCm39) missense probably damaging 1.00
R4798:Vps13d UTSW 4 144,904,626 (GRCm39) missense probably damaging 0.98
R4817:Vps13d UTSW 4 144,795,735 (GRCm39) missense probably damaging 1.00
R4839:Vps13d UTSW 4 144,812,000 (GRCm39) missense possibly damaging 0.95
R4860:Vps13d UTSW 4 144,813,731 (GRCm39) missense probably benign
R4860:Vps13d UTSW 4 144,813,731 (GRCm39) missense probably benign
R4869:Vps13d UTSW 4 144,854,612 (GRCm39) missense probably damaging 1.00
R4904:Vps13d UTSW 4 144,882,015 (GRCm39) missense probably damaging 1.00
R4912:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R4916:Vps13d UTSW 4 144,709,963 (GRCm39) missense probably damaging 1.00
R4976:Vps13d UTSW 4 144,832,468 (GRCm39) missense possibly damaging 0.82
R5029:Vps13d UTSW 4 144,882,852 (GRCm39) missense probably benign 0.02
R5049:Vps13d UTSW 4 144,813,336 (GRCm39) missense probably damaging 1.00
R5077:Vps13d UTSW 4 144,814,811 (GRCm39) missense probably damaging 0.98
R5119:Vps13d UTSW 4 144,832,468 (GRCm39) missense possibly damaging 0.82
R5227:Vps13d UTSW 4 144,907,777 (GRCm39) splice site probably null
R5291:Vps13d UTSW 4 144,789,139 (GRCm39) missense probably damaging 0.99
R5344:Vps13d UTSW 4 144,904,904 (GRCm39) missense probably damaging 0.98
R5348:Vps13d UTSW 4 144,792,459 (GRCm39) missense probably damaging 0.99
R5478:Vps13d UTSW 4 144,894,120 (GRCm39) missense probably damaging 0.99
R5632:Vps13d UTSW 4 144,801,452 (GRCm39) missense probably damaging 0.99
R5642:Vps13d UTSW 4 144,896,872 (GRCm39) missense possibly damaging 0.66
R5712:Vps13d UTSW 4 144,813,743 (GRCm39) missense probably benign 0.07
R5747:Vps13d UTSW 4 144,894,853 (GRCm39) missense probably benign 0.00
R5752:Vps13d UTSW 4 144,875,540 (GRCm39) missense probably benign 0.06
R5804:Vps13d UTSW 4 144,826,640 (GRCm39) missense probably benign 0.03
R5917:Vps13d UTSW 4 144,826,580 (GRCm39) missense probably damaging 0.96
R5932:Vps13d UTSW 4 144,771,611 (GRCm39) missense possibly damaging 0.71
R5940:Vps13d UTSW 4 144,801,545 (GRCm39) missense probably benign 0.09
R5978:Vps13d UTSW 4 144,849,181 (GRCm39) missense probably benign
R6031:Vps13d UTSW 4 144,895,079 (GRCm39) missense probably benign 0.01
R6031:Vps13d UTSW 4 144,895,079 (GRCm39) missense probably benign 0.01
R6143:Vps13d UTSW 4 144,875,135 (GRCm39) missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144,701,763 (GRCm39) nonsense probably null
R6191:Vps13d UTSW 4 144,875,918 (GRCm39) missense probably damaging 1.00
R6198:Vps13d UTSW 4 144,875,560 (GRCm39) missense probably benign 0.28
R6374:Vps13d UTSW 4 144,849,251 (GRCm39) missense probably damaging 1.00
R6379:Vps13d UTSW 4 144,814,828 (GRCm39) missense probably benign
R6388:Vps13d UTSW 4 144,882,144 (GRCm39) missense probably benign 0.06
R6418:Vps13d UTSW 4 144,818,850 (GRCm39) missense probably damaging 0.98
R6466:Vps13d UTSW 4 144,784,065 (GRCm39) missense possibly damaging 0.47
R6602:Vps13d UTSW 4 144,830,234 (GRCm39) intron probably benign
R6604:Vps13d UTSW 4 144,907,694 (GRCm39) missense probably damaging 1.00
R7051:Vps13d UTSW 4 144,889,914 (GRCm39) missense probably benign 0.00
R7052:Vps13d UTSW 4 144,889,914 (GRCm39) missense probably benign 0.00
R7103:Vps13d UTSW 4 144,842,062 (GRCm39) missense
R7231:Vps13d UTSW 4 144,784,032 (GRCm39) missense
R7246:Vps13d UTSW 4 144,882,620 (GRCm39) missense
R7339:Vps13d UTSW 4 144,847,938 (GRCm39) missense
R7409:Vps13d UTSW 4 144,867,824 (GRCm39) missense
R7419:Vps13d UTSW 4 144,842,073 (GRCm39) missense
R7424:Vps13d UTSW 4 144,875,317 (GRCm39) missense
R7439:Vps13d UTSW 4 144,832,426 (GRCm39) missense
R7440:Vps13d UTSW 4 144,854,981 (GRCm39) missense
R7528:Vps13d UTSW 4 144,818,492 (GRCm39) missense
R7547:Vps13d UTSW 4 144,784,108 (GRCm39) missense
R7558:Vps13d UTSW 4 144,881,150 (GRCm39) missense
R7699:Vps13d UTSW 4 144,811,975 (GRCm39) missense
R7729:Vps13d UTSW 4 144,801,622 (GRCm39) missense
R7789:Vps13d UTSW 4 144,826,635 (GRCm39) missense
R7813:Vps13d UTSW 4 144,904,633 (GRCm39) nonsense probably null
R7834:Vps13d UTSW 4 144,835,143 (GRCm39) missense
R7840:Vps13d UTSW 4 144,830,246 (GRCm39) missense
R7880:Vps13d UTSW 4 144,907,684 (GRCm39) critical splice donor site probably null
R7912:Vps13d UTSW 4 144,899,697 (GRCm39) missense
R7915:Vps13d UTSW 4 144,813,389 (GRCm39) missense
R7931:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
R8021:Vps13d UTSW 4 144,875,245 (GRCm39) missense
R8048:Vps13d UTSW 4 144,882,137 (GRCm39) missense
R8057:Vps13d UTSW 4 144,701,753 (GRCm39) missense
R8063:Vps13d UTSW 4 144,841,327 (GRCm39) missense
R8131:Vps13d UTSW 4 144,882,707 (GRCm39) missense
R8190:Vps13d UTSW 4 144,879,321 (GRCm39) missense
R8226:Vps13d UTSW 4 144,875,860 (GRCm39) missense
R8241:Vps13d UTSW 4 144,875,047 (GRCm39) missense
R8254:Vps13d UTSW 4 144,709,882 (GRCm39) splice site probably benign
R8305:Vps13d UTSW 4 144,818,858 (GRCm39) missense
R8415:Vps13d UTSW 4 144,818,549 (GRCm39) missense
R8460:Vps13d UTSW 4 144,897,009 (GRCm39) intron probably benign
R8487:Vps13d UTSW 4 144,881,817 (GRCm39) missense probably benign 0.11
R8543:Vps13d UTSW 4 144,743,353 (GRCm39) nonsense probably null
R8679:Vps13d UTSW 4 144,811,977 (GRCm39) missense
R8716:Vps13d UTSW 4 144,802,348 (GRCm39) missense
R8749:Vps13d UTSW 4 144,865,183 (GRCm39) missense
R8772:Vps13d UTSW 4 144,801,602 (GRCm39) missense
R8788:Vps13d UTSW 4 144,813,305 (GRCm39) missense
R8789:Vps13d UTSW 4 144,795,743 (GRCm39) missense
R8836:Vps13d UTSW 4 144,882,648 (GRCm39) missense
R8874:Vps13d UTSW 4 144,881,772 (GRCm39) missense
R8918:Vps13d UTSW 4 144,772,873 (GRCm39) missense
R9129:Vps13d UTSW 4 144,898,249 (GRCm39) missense
R9220:Vps13d UTSW 4 144,783,058 (GRCm39) missense
R9233:Vps13d UTSW 4 144,879,344 (GRCm39) missense
R9234:Vps13d UTSW 4 144,875,792 (GRCm39) missense
R9256:Vps13d UTSW 4 144,882,374 (GRCm39) missense
R9350:Vps13d UTSW 4 144,882,333 (GRCm39) missense
R9398:Vps13d UTSW 4 144,896,956 (GRCm39) nonsense probably null
R9415:Vps13d UTSW 4 144,796,527 (GRCm39) missense
R9438:Vps13d UTSW 4 144,858,314 (GRCm39) missense
R9469:Vps13d UTSW 4 144,780,691 (GRCm39) missense
R9487:Vps13d UTSW 4 144,807,869 (GRCm39) critical splice donor site probably null
R9524:Vps13d UTSW 4 144,822,814 (GRCm39) missense
R9616:Vps13d UTSW 4 144,824,701 (GRCm39) missense
R9655:Vps13d UTSW 4 144,813,305 (GRCm39) missense
R9709:Vps13d UTSW 4 144,875,915 (GRCm39) missense
R9767:Vps13d UTSW 4 144,879,306 (GRCm39) missense
R9773:Vps13d UTSW 4 144,818,619 (GRCm39) missense
R9779:Vps13d UTSW 4 144,798,972 (GRCm39) missense
R9796:Vps13d UTSW 4 144,854,505 (GRCm39) critical splice donor site probably null
X0021:Vps13d UTSW 4 144,881,595 (GRCm39) missense probably damaging 0.99
Z1176:Vps13d UTSW 4 144,833,637 (GRCm39) missense
Z1177:Vps13d UTSW 4 144,904,866 (GRCm39) missense
Z1177:Vps13d UTSW 4 144,881,478 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGAAGCCCTTGCGAATAGAAC -3'
(R):5'- CTTAAGTTTGCTCAGGCTCAGC -3'

Sequencing Primer
(F):5'- GCCCTTGCGAATAGAACATATTAAGG -3'
(R):5'- GGCTCAGCCCTTTCTGCTTG -3'
Posted On 2015-10-08