Incidental Mutation 'R0268:Mycbp2'
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene NameMYC binding protein 2
SynonymsC130061D10Rik, Phr1, Pam
MMRRC Submission 038494-MU
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0268 (G1)
Quality Score131
Status Validated
Chromosomal Location103113411-103346814 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103314325 bp
Amino Acid Change Arginine to Stop codon at position 157 (R157*)
Ref Sequence ENSEMBL: ENSMUSP00000124601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
Predicted Effect probably null
Transcript: ENSMUST00000159855
AA Change: R190*
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: R190*

low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160758
AA Change: R157*
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: R157*

low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162537
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103223050 missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103155808 missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103201352 missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103194621 missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103126753 missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103291283 splice site probably benign
IGL00960:Mycbp2 APN 14 103229384 missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103172642 missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103122547 missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103155510 missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103229492 splice site probably null
IGL01586:Mycbp2 APN 14 103140869 critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103291287 critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103127979 missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103135204 nonsense probably null
IGL01820:Mycbp2 APN 14 103188501 missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103143211 missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103154907 nonsense probably null
IGL02178:Mycbp2 APN 14 103224366 missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103242207 missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103314375 missense probably benign
IGL02607:Mycbp2 APN 14 103285273 missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103205185 missense probably benign
IGL02702:Mycbp2 APN 14 103220124 missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103155261 missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103114242 splice site probably benign
IGL02866:Mycbp2 APN 14 103129992 missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103177279 missense probably benign
IGL03082:Mycbp2 APN 14 103204369 missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103298776 missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103155453 missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103298698 missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103188589 missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103247758 missense probably damaging 1.00
decompose UTSW 14 103219979 missense probably benign 0.12
moulder UTSW 14 103188592 missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103224462 splice site probably benign
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103152142 missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103156634 unclassified probably benign
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0388:Mycbp2 UTSW 14 103156667 missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103135133 missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103182459 missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103196391 unclassified probably benign
R0671:Mycbp2 UTSW 14 103194588 missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103174794 missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103220013 missense probably benign
R0903:Mycbp2 UTSW 14 103275857 missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103262693 unclassified probably benign
R0961:Mycbp2 UTSW 14 103184835 missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103140917 missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103174826 missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103200152 nonsense probably null
R1211:Mycbp2 UTSW 14 103120563 missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103208782 missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103155898 missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103298867 splice site probably benign
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103204389 missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103232597 missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103169851 splice site probably null
R1565:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103247758 missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103227511 missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103224416 missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103182419 missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103155714 missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103184883 missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103229404 missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103145971 missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103248403 missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103188592 missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103260239 missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103232524 critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103287260 missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103220076 missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103201230 missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103145942 missense probably benign
R2135:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2146:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103169855 critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103169859 missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103262749 missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103144338 missense probably null 0.66
R2379:Mycbp2 UTSW 14 103174950 missense probably benign
R2495:Mycbp2 UTSW 14 103200118 missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103131245 missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103155255 missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103297358 missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103208743 splice site probably benign
R3404:Mycbp2 UTSW 14 103200114 missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103135117 missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103229430 missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103156414 missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103133788 missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103197285 missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103174797 missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103126713 missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103204500 missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103295252 missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103138725 splice site probably benign
R4021:Mycbp2 UTSW 14 103152157 missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103248457 missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103123445 missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103287228 missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103135266 missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103133789 missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103188502 missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103155658 missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103346297 missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103177313 missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103188591 missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103219944 missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103229437 missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103211295 missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103145946 missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103287239 missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103260385 intron probably null
R4994:Mycbp2 UTSW 14 103169994 missense probably benign
R5029:Mycbp2 UTSW 14 103156510 missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103296939 missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103139235 critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103346214 critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103346321 missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103185683 critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103242432 nonsense probably null
R5414:Mycbp2 UTSW 14 103306261 missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103201401 missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103200126 missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103242179 missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103173814 missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103295237 missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103282645 nonsense probably null
R5569:Mycbp2 UTSW 14 103135243 missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103142767 missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103291333 missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103123355 missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103194677 missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188608 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188615 critical splice acceptor site probably null
R5646:Mycbp2 UTSW 14 103169910 missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103291342 missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103282665 missense probably null 0.99
R5668:Mycbp2 UTSW 14 103120519 missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103156453 missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103148550 missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103133974 missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103124403 missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103126684 missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103156723 missense probably benign
R6063:Mycbp2 UTSW 14 103135146 missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103223046 missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103275887 missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103285400 missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103155509 nonsense probably null
R6161:Mycbp2 UTSW 14 103298747 missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103147017 missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103295228 missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103260229 missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103155426 missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103262740 missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103155852 missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103155475 missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103136557 critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103142881 missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103191567 missense probably null 1.00
R6821:Mycbp2 UTSW 14 103139409 missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103260194 critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103285267 missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103154906 missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103206681 missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103174981 missense probably benign
R7054:Mycbp2 UTSW 14 103156098 missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103122603 missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103154077 missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103282679 missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103260200 missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103133846 missense probably benign
R7234:Mycbp2 UTSW 14 103215337 missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103156297 missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103208909 missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103197243 critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103120591 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103156453 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103197357 missense probably damaging 0.97
R7384:Mycbp2 UTSW 14 103276393 missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103152191 missense probably damaging 1.00
R7392:Mycbp2 UTSW 14 103243128 missense probably damaging 0.99
R7409:Mycbp2 UTSW 14 103288744 missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103197254 missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103346265 missense probably benign
R7661:Mycbp2 UTSW 14 103212623 missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103191609 missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103123355 missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103191619 missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103248404 missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103127097 missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103139415 missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
R7921:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7924:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7941:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7956:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7992:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
X0024:Mycbp2 UTSW 14 103146942 missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103156637 missense not run
Z1176:Mycbp2 UTSW 14 103346249 missense not run
Z1177:Mycbp2 UTSW 14 103127063 critical splice donor site unknown
Z1177:Mycbp2 UTSW 14 103135123 missense not run
Z1177:Mycbp2 UTSW 14 103169873 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gctttgttagccagtttaaaaatcc -3'
Posted On2013-05-09