Incidental Mutation 'R4613:Xirp1'
ID350983
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Namexin actin-binding repeat containing 1
SynonymsCmya1, Xin, mXin alpha
MMRRC Submission 041824-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R4613 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120013755-120023598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120019682 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 45 (F45S)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
Predicted Effect probably damaging
Transcript: ENSMUST00000111635
AA Change: F45S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: F45S

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Areg A G 5: 91,143,504 K102R probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gli2 A G 1: 118,837,511 V970A probably damaging Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map1b A T 13: 99,430,302 Y1970* probably null Het
Map2 A G 1: 66,425,469 N287D probably damaging Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Orc2 A T 1: 58,500,309 L57* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 120017919 missense probably damaging 1.00
IGL02105:Xirp1 APN 9 120016997 missense probably damaging 1.00
IGL03365:Xirp1 APN 9 120018539 missense probably damaging 0.99
busybody UTSW 9 120019753 missense possibly damaging 0.92
Buzzer UTSW 9 120018491 missense probably damaging 1.00
cornflower UTSW 9 120019815 start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 120017454 missense probably benign 0.01
R0320:Xirp1 UTSW 9 120016467 missense probably benign 0.00
R0881:Xirp1 UTSW 9 120018417 missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 120017916 missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 120018775 missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120016907 missense probably benign
R1785:Xirp1 UTSW 9 120016907 missense probably benign
R1978:Xirp1 UTSW 9 120018591 missense probably benign 0.00
R1983:Xirp1 UTSW 9 120016629 nonsense probably null
R2064:Xirp1 UTSW 9 120016896 missense probably benign 0.00
R2860:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2860:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2919:Xirp1 UTSW 9 120018701 missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 120019785 missense probably benign
R3704:Xirp1 UTSW 9 120016907 missense probably benign 0.04
R3898:Xirp1 UTSW 9 120019340 missense probably benign 0.00
R3981:Xirp1 UTSW 9 120017744 missense probably damaging 0.98
R4609:Xirp1 UTSW 9 120016506 missense probably benign
R4660:Xirp1 UTSW 9 120016992 missense probably damaging 1.00
R4703:Xirp1 UTSW 9 120017027 missense probably damaging 1.00
R4825:Xirp1 UTSW 9 120017003 missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 120018792 missense probably damaging 1.00
R5297:Xirp1 UTSW 9 120019602 missense probably damaging 1.00
R5939:Xirp1 UTSW 9 120018509 missense probably benign 0.01
R6091:Xirp1 UTSW 9 120017963 missense probably benign 0.01
R6290:Xirp1 UTSW 9 120018725 missense probably benign
R6376:Xirp1 UTSW 9 120018491 missense probably damaging 1.00
R6515:Xirp1 UTSW 9 120016917 missense probably benign 0.00
R6616:Xirp1 UTSW 9 120019014 missense probably damaging 0.98
R6976:Xirp1 UTSW 9 120017918 missense probably damaging 1.00
R7165:Xirp1 UTSW 9 120019047 missense probably damaging 1.00
R7471:Xirp1 UTSW 9 120019110 nonsense probably null
R7744:Xirp1 UTSW 9 120016846 missense possibly damaging 0.77
R7847:Xirp1 UTSW 9 120019753 missense possibly damaging 0.92
R8010:Xirp1 UTSW 9 120017824 missense probably benign 0.00
R8371:Xirp1 UTSW 9 120019433 missense possibly damaging 0.78
R8868:Xirp1 UTSW 9 120017805 missense probably benign
V8831:Xirp1 UTSW 9 120016907 missense probably benign
X0025:Xirp1 UTSW 9 120019155 missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120016907 missense probably benign
Z1176:Xirp1 UTSW 9 120016880 missense probably damaging 0.96
Z1176:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120017154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCCAGTTCTCAAAGATCCAG -3'
(R):5'- ATGTGGGAGCCCCTTAGTAGTG -3'

Sequencing Primer
(F):5'- GTTCTCAAAGATCCAGCGCATAC -3'
(R):5'- TCTCGTGCTAGTTAACCCAGGAAC -3'
Posted On2015-10-08