Incidental Mutation 'R4613:Xirp1'
ID 350983
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Name xin actin-binding repeat containing 1
Synonyms Cmya1, Xin, mXin alpha
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.418) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 119842821-119852660 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119848748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 45 (F45S)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000111635
AA Change: F45S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: F45S

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 119,846,985 (GRCm39) missense probably damaging 1.00
IGL02105:Xirp1 APN 9 119,846,063 (GRCm39) missense probably damaging 1.00
IGL03365:Xirp1 APN 9 119,847,605 (GRCm39) missense probably damaging 0.99
busybody UTSW 9 119,848,819 (GRCm39) missense possibly damaging 0.92
Buzzer UTSW 9 119,847,557 (GRCm39) missense probably damaging 1.00
cornflower UTSW 9 119,848,881 (GRCm39) start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 119,846,520 (GRCm39) missense probably benign 0.01
R0320:Xirp1 UTSW 9 119,845,533 (GRCm39) missense probably benign 0.00
R0881:Xirp1 UTSW 9 119,847,483 (GRCm39) missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 119,846,982 (GRCm39) missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 119,847,841 (GRCm39) missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
R1785:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
R1978:Xirp1 UTSW 9 119,847,657 (GRCm39) missense probably benign 0.00
R1983:Xirp1 UTSW 9 119,845,695 (GRCm39) nonsense probably null
R2064:Xirp1 UTSW 9 119,845,962 (GRCm39) missense probably benign 0.00
R2860:Xirp1 UTSW 9 119,848,881 (GRCm39) start codon destroyed probably null 0.89
R2860:Xirp1 UTSW 9 119,847,444 (GRCm39) missense probably benign 0.04
R2861:Xirp1 UTSW 9 119,847,444 (GRCm39) missense probably benign 0.04
R2861:Xirp1 UTSW 9 119,848,881 (GRCm39) start codon destroyed probably null 0.89
R2919:Xirp1 UTSW 9 119,847,767 (GRCm39) missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 119,848,851 (GRCm39) missense probably benign
R3704:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign 0.04
R3898:Xirp1 UTSW 9 119,848,406 (GRCm39) missense probably benign 0.00
R3981:Xirp1 UTSW 9 119,846,810 (GRCm39) missense probably damaging 0.98
R4609:Xirp1 UTSW 9 119,845,572 (GRCm39) missense probably benign
R4660:Xirp1 UTSW 9 119,846,058 (GRCm39) missense probably damaging 1.00
R4703:Xirp1 UTSW 9 119,846,093 (GRCm39) missense probably damaging 1.00
R4825:Xirp1 UTSW 9 119,846,069 (GRCm39) missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 119,847,858 (GRCm39) missense probably damaging 1.00
R5297:Xirp1 UTSW 9 119,848,668 (GRCm39) missense probably damaging 1.00
R5939:Xirp1 UTSW 9 119,847,575 (GRCm39) missense probably benign 0.01
R6091:Xirp1 UTSW 9 119,847,029 (GRCm39) missense probably benign 0.01
R6290:Xirp1 UTSW 9 119,847,791 (GRCm39) missense probably benign
R6376:Xirp1 UTSW 9 119,847,557 (GRCm39) missense probably damaging 1.00
R6515:Xirp1 UTSW 9 119,845,983 (GRCm39) missense probably benign 0.00
R6616:Xirp1 UTSW 9 119,848,080 (GRCm39) missense probably damaging 0.98
R6976:Xirp1 UTSW 9 119,846,984 (GRCm39) missense probably damaging 1.00
R7165:Xirp1 UTSW 9 119,848,113 (GRCm39) missense probably damaging 1.00
R7471:Xirp1 UTSW 9 119,848,176 (GRCm39) nonsense probably null
R7744:Xirp1 UTSW 9 119,845,912 (GRCm39) missense possibly damaging 0.77
R7847:Xirp1 UTSW 9 119,848,819 (GRCm39) missense possibly damaging 0.92
R8010:Xirp1 UTSW 9 119,846,890 (GRCm39) missense probably benign 0.00
R8371:Xirp1 UTSW 9 119,848,499 (GRCm39) missense possibly damaging 0.78
R8868:Xirp1 UTSW 9 119,846,871 (GRCm39) missense probably benign
R9165:Xirp1 UTSW 9 119,847,302 (GRCm39) missense probably benign 0.05
R9342:Xirp1 UTSW 9 119,845,950 (GRCm39) missense probably benign
R9440:Xirp1 UTSW 9 119,847,203 (GRCm39) missense probably damaging 1.00
R9527:Xirp1 UTSW 9 119,847,558 (GRCm39) missense probably damaging 1.00
R9605:Xirp1 UTSW 9 119,847,274 (GRCm39) missense possibly damaging 0.77
R9629:Xirp1 UTSW 9 119,846,379 (GRCm39) missense probably benign 0.00
V8831:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
X0025:Xirp1 UTSW 9 119,848,221 (GRCm39) missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
Z1176:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
Z1176:Xirp1 UTSW 9 119,845,946 (GRCm39) missense probably damaging 0.96
Z1177:Xirp1 UTSW 9 119,846,220 (GRCm39) missense probably damaging 0.99
Z1177:Xirp1 UTSW 9 120,016,907 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCCAGTTCTCAAAGATCCAG -3'
(R):5'- ATGTGGGAGCCCCTTAGTAGTG -3'

Sequencing Primer
(F):5'- GTTCTCAAAGATCCAGCGCATAC -3'
(R):5'- TCTCGTGCTAGTTAACCCAGGAAC -3'
Posted On 2015-10-08