Incidental Mutation 'R4613:L3mbtl3'
ID 350984
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene Name L3MBTL3 histone methyl-lysine binding protein
Synonyms MBT-1
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 26150366-26251967 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26158693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 652 (S652T)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
AlphaFold Q8BLB7
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: S652T
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: S652T

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: S627T
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: S627T

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: S652T
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: S652T

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218585
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26,189,744 (GRCm39) critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26,206,083 (GRCm39) missense unknown
IGL01712:L3mbtl3 APN 10 26,152,133 (GRCm39) missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26,207,798 (GRCm39) missense unknown
IGL01928:L3mbtl3 APN 10 26,206,143 (GRCm39) missense unknown
IGL01955:L3mbtl3 APN 10 26,194,336 (GRCm39) missense unknown
IGL02674:L3mbtl3 APN 10 26,158,711 (GRCm39) missense unknown
IGL02731:L3mbtl3 APN 10 26,220,074 (GRCm39) critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26,218,515 (GRCm39) missense unknown
IGL03252:L3mbtl3 APN 10 26,207,710 (GRCm39) splice site probably benign
IGL03298:L3mbtl3 APN 10 26,158,696 (GRCm39) missense unknown
IGL03400:L3mbtl3 APN 10 26,191,424 (GRCm39) missense unknown
R0121:L3mbtl3 UTSW 10 26,189,768 (GRCm39) missense unknown
R0468:L3mbtl3 UTSW 10 26,203,630 (GRCm39) missense unknown
R0497:L3mbtl3 UTSW 10 26,158,772 (GRCm39) splice site probably benign
R0586:L3mbtl3 UTSW 10 26,203,732 (GRCm39) missense unknown
R0633:L3mbtl3 UTSW 10 26,178,583 (GRCm39) missense unknown
R0679:L3mbtl3 UTSW 10 26,189,831 (GRCm39) nonsense probably null
R1302:L3mbtl3 UTSW 10 26,203,667 (GRCm39) missense unknown
R2128:L3mbtl3 UTSW 10 26,189,766 (GRCm39) missense unknown
R2267:L3mbtl3 UTSW 10 26,207,755 (GRCm39) nonsense probably null
R3121:L3mbtl3 UTSW 10 26,220,119 (GRCm39) intron probably benign
R3410:L3mbtl3 UTSW 10 26,215,197 (GRCm39) missense unknown
R4237:L3mbtl3 UTSW 10 26,216,846 (GRCm39) missense unknown
R4257:L3mbtl3 UTSW 10 26,156,020 (GRCm39) missense unknown
R4308:L3mbtl3 UTSW 10 26,158,690 (GRCm39) missense unknown
R4359:L3mbtl3 UTSW 10 26,203,639 (GRCm39) missense unknown
R4407:L3mbtl3 UTSW 10 26,189,782 (GRCm39) missense unknown
R4663:L3mbtl3 UTSW 10 26,213,715 (GRCm39) missense unknown
R4843:L3mbtl3 UTSW 10 26,207,777 (GRCm39) missense unknown
R4886:L3mbtl3 UTSW 10 26,168,668 (GRCm39) missense unknown
R5158:L3mbtl3 UTSW 10 26,179,586 (GRCm39) missense unknown
R5247:L3mbtl3 UTSW 10 26,203,706 (GRCm39) missense unknown
R5580:L3mbtl3 UTSW 10 26,179,604 (GRCm39) missense unknown
R5966:L3mbtl3 UTSW 10 26,207,762 (GRCm39) missense unknown
R6218:L3mbtl3 UTSW 10 26,168,645 (GRCm39) missense unknown
R6508:L3mbtl3 UTSW 10 26,194,325 (GRCm39) missense unknown
R6563:L3mbtl3 UTSW 10 26,178,761 (GRCm39) splice site probably null
R6709:L3mbtl3 UTSW 10 26,158,695 (GRCm39) missense unknown
R6927:L3mbtl3 UTSW 10 26,168,567 (GRCm39) nonsense probably null
R6984:L3mbtl3 UTSW 10 26,158,753 (GRCm39) missense unknown
R7010:L3mbtl3 UTSW 10 26,158,759 (GRCm39) critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26,168,560 (GRCm39) missense unknown
R7231:L3mbtl3 UTSW 10 26,215,180 (GRCm39) missense unknown
R7296:L3mbtl3 UTSW 10 26,158,728 (GRCm39) missense unknown
R7363:L3mbtl3 UTSW 10 26,216,850 (GRCm39) missense unknown
R7490:L3mbtl3 UTSW 10 26,215,129 (GRCm39) missense unknown
R7775:L3mbtl3 UTSW 10 26,228,215 (GRCm39) missense unknown
R7815:L3mbtl3 UTSW 10 26,156,276 (GRCm39) missense unknown
R8272:L3mbtl3 UTSW 10 26,179,566 (GRCm39) missense unknown
R8762:L3mbtl3 UTSW 10 26,152,121 (GRCm39) missense probably damaging 1.00
R8925:L3mbtl3 UTSW 10 26,220,084 (GRCm39) missense unknown
R8927:L3mbtl3 UTSW 10 26,220,084 (GRCm39) missense unknown
R9043:L3mbtl3 UTSW 10 26,156,152 (GRCm39) missense unknown
R9228:L3mbtl3 UTSW 10 26,212,155 (GRCm39) missense unknown
Z1177:L3mbtl3 UTSW 10 26,178,561 (GRCm39) missense unknown
Z1177:L3mbtl3 UTSW 10 26,156,300 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTTGGTTTCCAGGAAGGG -3'
(R):5'- ACAGTTGCGCCGTCAGAATG -3'

Sequencing Primer
(F):5'- GGGAAAAACAAACCAAGTTTATCTC -3'
(R):5'- TCAGAATGGCCGAGTGGTC -3'
Posted On 2015-10-08