Incidental Mutation 'R4613:Aoc3'
ID 350987
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Name amine oxidase, copper containing 3
Synonyms semicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101221432-101230256 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 101228485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000103105]
AlphaFold O70423
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103105
AA Change: D764V
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: D764V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187880
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101,228,304 (GRCm39) missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101,228,421 (GRCm39) missense probably benign
IGL02500:Aoc3 APN 11 101,228,215 (GRCm39) nonsense probably null
R0463:Aoc3 UTSW 11 101,222,432 (GRCm39) missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101,228,337 (GRCm39) missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101,222,964 (GRCm39) missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101,227,273 (GRCm39) missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101,223,158 (GRCm39) missense probably benign 0.01
R0946:Aoc3 UTSW 11 101,223,131 (GRCm39) missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101,227,261 (GRCm39) missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101,222,293 (GRCm39) nonsense probably null
R3735:Aoc3 UTSW 11 101,223,045 (GRCm39) missense probably damaging 0.99
R4497:Aoc3 UTSW 11 101,222,871 (GRCm39) missense possibly damaging 0.70
R4858:Aoc3 UTSW 11 101,222,488 (GRCm39) missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101,222,925 (GRCm39) missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101,221,800 (GRCm39) missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101,222,578 (GRCm39) nonsense probably null
R6679:Aoc3 UTSW 11 101,222,279 (GRCm39) missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101,228,229 (GRCm39) missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101,223,338 (GRCm39) missense probably benign 0.00
R7888:Aoc3 UTSW 11 101,223,323 (GRCm39) missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101,223,132 (GRCm39) missense probably benign 0.00
R8444:Aoc3 UTSW 11 101,232,573 (GRCm39) missense unknown
R8491:Aoc3 UTSW 11 101,223,042 (GRCm39) missense probably benign 0.41
R8685:Aoc3 UTSW 11 101,223,042 (GRCm39) missense probably benign 0.00
R8732:Aoc3 UTSW 11 101,222,643 (GRCm39) missense probably benign 0.00
R9660:Aoc3 UTSW 11 101,221,914 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATAACTTCTTTGACGAGGACCC -3'
(R):5'- TTTCCATGGGCTCAGGATGC -3'

Sequencing Primer
(F):5'- AGGACCCCTCCTTTCATTCTG -3'
(R):5'- ATGGGCTCAGGATGCTCCAAG -3'
Posted On 2015-10-08