Incidental Mutation 'R4613:Ccdc40'
ID 350989
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Name coiled-coil domain containing 40
Synonyms B930008I02Rik
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119119398-119156064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 119122358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 53 (R53S)
Ref Sequence ENSEMBL: ENSMUSP00000062198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035935] [ENSMUST00000036113] [ENSMUST00000053440] [ENSMUST00000207655]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035935
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036113
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053440
AA Change: R53S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963
AA Change: R53S

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150358
Predicted Effect probably benign
Transcript: ENSMUST00000207655
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119,133,545 (GRCm39) missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119,133,911 (GRCm39) missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119,122,797 (GRCm39) splice site probably null
IGL02640:Ccdc40 APN 11 119,128,904 (GRCm39) missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119,133,336 (GRCm39) missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119,154,027 (GRCm39) missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119,133,277 (GRCm39) missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119,133,630 (GRCm39) missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119,122,629 (GRCm39) missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119,154,015 (GRCm39) missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119,150,730 (GRCm39) missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119,153,901 (GRCm39) splice site probably null
R2106:Ccdc40 UTSW 11 119,155,123 (GRCm39) missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119,153,943 (GRCm39) missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119,125,605 (GRCm39) missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119,155,107 (GRCm39) missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119,133,335 (GRCm39) missense probably damaging 0.98
R4663:Ccdc40 UTSW 11 119,122,332 (GRCm39) missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119,144,447 (GRCm39) missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119,122,614 (GRCm39) missense probably benign
R5237:Ccdc40 UTSW 11 119,150,802 (GRCm39) missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119,128,753 (GRCm39) missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119,122,398 (GRCm39) missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119,136,906 (GRCm39) critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119,133,572 (GRCm39) missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119,144,229 (GRCm39) missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119,141,838 (GRCm39) missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119,122,804 (GRCm39) missense probably benign
R6166:Ccdc40 UTSW 11 119,122,827 (GRCm39) missense probably benign
R6336:Ccdc40 UTSW 11 119,122,819 (GRCm39) missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119,133,560 (GRCm39) missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119,133,565 (GRCm39) missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119,122,612 (GRCm39) missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119,155,270 (GRCm39) missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119,153,974 (GRCm39) missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119,123,047 (GRCm39) missense possibly damaging 0.73
R7888:Ccdc40 UTSW 11 119,119,967 (GRCm39) missense unknown
R8041:Ccdc40 UTSW 11 119,122,507 (GRCm39) missense possibly damaging 0.53
R8117:Ccdc40 UTSW 11 119,144,211 (GRCm39) missense probably benign 0.00
R8162:Ccdc40 UTSW 11 119,150,870 (GRCm39) critical splice donor site probably null
R8514:Ccdc40 UTSW 11 119,121,459 (GRCm39) missense unknown
R8725:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8727:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8799:Ccdc40 UTSW 11 119,155,292 (GRCm39) missense probably benign 0.00
R8877:Ccdc40 UTSW 11 119,153,992 (GRCm39) missense probably damaging 1.00
R9304:Ccdc40 UTSW 11 119,122,597 (GRCm39) missense probably benign 0.06
S24628:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
Z1176:Ccdc40 UTSW 11 119,142,834 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc40 UTSW 11 119,145,224 (GRCm39) missense probably benign 0.16
Z1177:Ccdc40 UTSW 11 119,128,933 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTGTAACACGTGCCTCTAG -3'
(R):5'- AATTCCACATCTGTGTCTGGAGC -3'

Sequencing Primer
(F):5'- CTCTAGAAAGAGGCAGTAGTTACATC -3'
(R):5'- GAGCGGTCTCTCCAATGAATTC -3'
Posted On 2015-10-08