Incidental Mutation 'R4613:Map1b'
ID 350992
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 041824-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 99430302 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1970 (Y1970*)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect probably null
Transcript: ENSMUST00000064762
AA Change: Y1970*
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: Y1970*

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Areg A G 5: 91,143,504 K102R probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gli2 A G 1: 118,837,511 V970A probably damaging Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map2 A G 1: 66,425,469 N287D probably damaging Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Orc2 A T 1: 58,500,309 L57* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xirp1 A G 9: 120,019,682 F45S probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTCCATGGTCTCGTAACAGTATG -3'
(R):5'- AAATCCCCATGTGACAGTGGG -3'

Sequencing Primer
(F):5'- CTCGTAACAGTATGCAGAGGTGTC -3'
(R):5'- TGACAGTGGGTACTCCTATGAGACC -3'
Posted On 2015-10-08