Incidental Mutation 'R4613:Or10al4'
ID 351010
Institutional Source Beutler Lab
Gene Symbol Or10al4
Ensembl Gene ENSMUSG00000063994
Gene Name olfactory receptor family 10 subfamily AL member 4
Synonyms Olfr120, MOR263-3, GA_x6K02T2PSCP-2184981-2185946
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 38036890-38037882 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38037587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000146861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077498] [ENSMUST00000207771]
AlphaFold Q8VFQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000077498
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094931
Gene: ENSMUSG00000063994
AA Change: Y233C

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 1e-5 PFAM
Pfam:7tm_1 56 305 6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207771
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Or10al4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Or10al4 APN 17 38,037,193 (GRCm39) missense probably benign 0.08
IGL01925:Or10al4 APN 17 38,037,002 (GRCm39) missense probably benign 0.18
IGL02901:Or10al4 APN 17 38,037,311 (GRCm39) missense probably damaging 1.00
PIT4687001:Or10al4 UTSW 17 38,037,082 (GRCm39) missense probably benign 0.01
R1645:Or10al4 UTSW 17 38,037,229 (GRCm39) missense probably benign 0.01
R2218:Or10al4 UTSW 17 38,037,145 (GRCm39) missense probably damaging 0.97
R2336:Or10al4 UTSW 17 38,037,689 (GRCm39) missense probably benign 0.07
R5237:Or10al4 UTSW 17 38,037,268 (GRCm39) missense probably damaging 1.00
R5880:Or10al4 UTSW 17 38,037,545 (GRCm39) missense probably benign 0.09
R6187:Or10al4 UTSW 17 38,037,032 (GRCm39) missense probably damaging 0.99
R9083:Or10al4 UTSW 17 38,037,060 (GRCm39) missense probably damaging 1.00
R9479:Or10al4 UTSW 17 38,036,986 (GRCm39) missense probably damaging 0.99
R9647:Or10al4 UTSW 17 38,037,796 (GRCm39) missense probably damaging 1.00
Z1088:Or10al4 UTSW 17 38,036,983 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTAGGGTTGGGACAGACC -3'
(R):5'- TGGGGTTCAGCATGGAAGTC -3'

Sequencing Primer
(F):5'- GGGACAGACCAATTTTATTTTCTCC -3'
(R):5'- TTCAGCATGGAAGTCACCGC -3'
Posted On 2015-10-08