Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Lamc2'

351019

Institutional Source

Beutler Lab

Gene Symbol

Lamc2

Ensembl Gene

ENSMUSG00000026479

Gene Name

laminin, gamma 2

Synonyms

nicein, 100kDa

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.469) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153122756-153186447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153166169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 73 (Y73C)

Ref Sequence

ENSEMBL: ENSMUSP00000140514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027753
AA Change: Y73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: Y73C

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185356
AA Change: Y73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: Y73C

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188831

Meta Mutation Damage Score

0.6926

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Lamc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Lamc2	APN	1	153130056	missense	probably benign	0.00
IGL00907:Lamc2	APN	1	153144651	missense	probably benign	0.32
IGL02026:Lamc2	APN	1	153144736	splice site	probably benign
IGL02335:Lamc2	APN	1	153166216	missense	probably benign	0.00
IGL02568:Lamc2	APN	1	153166262	missense	possibly damaging	0.91
IGL02640:Lamc2	APN	1	153152057	missense	probably damaging	0.99
IGL02801:Lamc2	APN	1	153136783	missense	probably benign	0.10
IGL02827:Lamc2	APN	1	153139781	missense	probably damaging	1.00
IGL03240:Lamc2	APN	1	153124125	missense	probably damaging	1.00
IGL03245:Lamc2	APN	1	153133757	splice site	probably null
abasement	UTSW	1	153127025	missense	probably null	0.86
ANU74:Lamc2	UTSW	1	153131835	missense	probably benign	0.00
R0279:Lamc2	UTSW	1	153130696	missense	probably benign	0.01
R0528:Lamc2	UTSW	1	153124094	missense	probably damaging	1.00
R0597:Lamc2	UTSW	1	153133621	missense	probably benign	0.02
R0650:Lamc2	UTSW	1	153143876	missense	possibly damaging	0.88
R0826:Lamc2	UTSW	1	153152082	missense	probably damaging	1.00
R1015:Lamc2	UTSW	1	153166199	missense	possibly damaging	0.53
R1172:Lamc2	UTSW	1	153166287	missense	probably damaging	1.00
R1308:Lamc2	UTSW	1	153150818	missense	probably damaging	1.00
R1521:Lamc2	UTSW	1	153166263	missense	probably benign	0.11
R1525:Lamc2	UTSW	1	153130756	missense	probably benign	0.00
R1602:Lamc2	UTSW	1	153127028	missense	probably benign	0.00
R1631:Lamc2	UTSW	1	153158934	missense	possibly damaging	0.95
R1633:Lamc2	UTSW	1	153141698	nonsense	probably null
R1832:Lamc2	UTSW	1	153166187	missense	possibly damaging	0.72
R1978:Lamc2	UTSW	1	153133597	critical splice donor site	probably null
R1996:Lamc2	UTSW	1	153154470	missense	possibly damaging	0.84
R2046:Lamc2	UTSW	1	153141765	missense	probably benign	0.01
R2107:Lamc2	UTSW	1	153154386	splice site	probably benign
R2130:Lamc2	UTSW	1	153127124	missense	probably damaging	1.00
R2182:Lamc2	UTSW	1	153126866	missense	possibly damaging	0.46
R2207:Lamc2	UTSW	1	153133706	missense	possibly damaging	0.68
R2218:Lamc2	UTSW	1	153130779	missense	probably benign	0.21
R3772:Lamc2	UTSW	1	153124251	missense	probably benign
R4874:Lamc2	UTSW	1	153154395	missense	probably null	1.00
R4939:Lamc2	UTSW	1	153126836	missense	probably damaging	1.00
R4985:Lamc2	UTSW	1	153136805	missense	probably benign
R5544:Lamc2	UTSW	1	153124053	missense	possibly damaging	0.93
R5632:Lamc2	UTSW	1	153131890	missense	probably damaging	1.00
R5771:Lamc2	UTSW	1	153141594	missense	probably benign	0.04
R5811:Lamc2	UTSW	1	153166253	missense	possibly damaging	0.53
R6058:Lamc2	UTSW	1	153136829	missense	probably benign	0.01
R6130:Lamc2	UTSW	1	153136777	missense	probably benign	0.01
R6137:Lamc2	UTSW	1	153166153	missense	possibly damaging	0.90
R6994:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6995:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6997:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R7000:Lamc2	UTSW	1	153166127	missense	possibly damaging	0.72
R7018:Lamc2	UTSW	1	153136742	missense	probably benign	0.00
R7145:Lamc2	UTSW	1	153130772	missense	possibly damaging	0.95
R7148:Lamc2	UTSW	1	153185984	missense	probably benign	0.01
R7171:Lamc2	UTSW	1	153139749	missense	probably damaging	1.00
R7640:Lamc2	UTSW	1	153136804	missense	possibly damaging	0.79
R7673:Lamc2	UTSW	1	153124036	missense	probably damaging	1.00
R7684:Lamc2	UTSW	1	153127025	missense	probably null	0.86
R7712:Lamc2	UTSW	1	153133611	missense	possibly damaging	0.81
R7940:Lamc2	UTSW	1	153130775	nonsense	probably null
R8153:Lamc2	UTSW	1	153124104	frame shift	probably null
R8211:Lamc2	UTSW	1	153166278	missense	probably damaging	1.00
R8486:Lamc2	UTSW	1	153158891	missense	probably benign
R8739:Lamc2	UTSW	1	153144653	nonsense	probably null
R8744:Lamc2	UTSW	1	153143738	missense	probably benign	0.19
R8911:Lamc2	UTSW	1	153152127	missense	probably damaging	1.00
R9435:Lamc2	UTSW	1	153137326	missense	probably benign	0.00
R9457:Lamc2	UTSW	1	153139854	missense	probably benign
RF024:Lamc2	UTSW	1	153152055	missense	possibly damaging	0.70
Z1176:Lamc2	UTSW	1	153133621	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGATGAACCTGGCTCCTTCC -3'
(R):5'- GTCATGTTAGCCCATGCATAAC -3'

Sequencing Primer
(F):5'- CCCAGGGGGCGTTGTTAAAAC -3'
(R):5'- GTTAGCCCATGCATAACAGATG -3'

Posted On

2015-10-08