Incidental Mutation 'R0268:Clec16a'
ID35102
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission 038494-MU
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0268 (G1)
Quality Score213
Status Validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 10644828 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 670 (L670*)
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably null
Transcript: ENSMUST00000038145
AA Change: L686*
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663
AA Change: L686*

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066345
AA Change: L672*
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: L672*

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115823
AA Change: L251*
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663
AA Change: L251*

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115824
AA Change: L672*
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: L672*

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115827
AA Change: L686*
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663
AA Change: L686*

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145866
Predicted Effect probably null
Transcript: ENSMUST00000155633
AA Change: L670*
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: L670*

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 unclassified probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACCATGCAATGCCTTCATGCAG -3'
(R):5'- TCAAGGTTATAGGCTGGGCACAGG -3'

Sequencing Primer
(F):5'- TGCCTTCATGCAGGGCAC -3'
(R):5'- CCTAAATACTGGTGATGTGCTTC -3'
Posted On2013-05-09