Incidental Mutation 'R4616:Bpifa6'
ID351023
Institutional Source Beutler Lab
Gene Symbol Bpifa6
Ensembl Gene ENSMUSG00000078998
Gene NameBPI fold containing family A, member 6
SynonymsGm5840
MMRRC Submission 041827-MU
Accession Numbers

Genbank: NM_001080811MGI: 3647736  

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4616 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153974945-154000495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153982988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000105375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109753
AA Change: S28P

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: S28P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 176 319 1.4e-9 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Bpifa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Bpifa6 APN 2 153990466 missense probably benign 0.00
IGL01805:Bpifa6 APN 2 153984912 missense probably benign 0.03
IGL02246:Bpifa6 APN 2 153989276 missense probably damaging 0.98
IGL02275:Bpifa6 APN 2 153992272 missense probably benign 0.40
IGL02405:Bpifa6 APN 2 153990862 nonsense probably null
IGL02587:Bpifa6 APN 2 153989210 missense probably damaging 0.99
IGL03365:Bpifa6 APN 2 153989284 missense possibly damaging 0.71
F6893:Bpifa6 UTSW 2 153987158 missense probably damaging 1.00
FR4976:Bpifa6 UTSW 2 153986376 missense probably benign
FR4976:Bpifa6 UTSW 2 153986398 missense probably benign
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0132:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0799:Bpifa6 UTSW 2 153992272 missense probably benign 0.40
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1767:Bpifa6 UTSW 2 153987227 missense possibly damaging 0.95
R2255:Bpifa6 UTSW 2 153990895 missense probably damaging 0.98
R2857:Bpifa6 UTSW 2 153989274 missense probably benign 0.03
R3430:Bpifa6 UTSW 2 153989251 missense probably benign 0.00
R5420:Bpifa6 UTSW 2 153989330 missense probably damaging 0.98
R6224:Bpifa6 UTSW 2 153987153 missense probably damaging 0.99
R6483:Bpifa6 UTSW 2 153990434 missense probably benign 0.13
R6552:Bpifa6 UTSW 2 153987158 missense probably damaging 0.99
R7061:Bpifa6 UTSW 2 153992316 missense probably benign 0.00
R7378:Bpifa6 UTSW 2 153986433 missense probably damaging 0.99
R7472:Bpifa6 UTSW 2 153989329 missense possibly damaging 0.93
R8313:Bpifa6 UTSW 2 153989258 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCTGCATAAGACCCCAGG -3'
(R):5'- CTACCTGGGAAGTGGATGTAAAATG -3'

Sequencing Primer
(F):5'- TGCATAAGACCCCAGGACTCTG -3'
(R):5'- TAGATCTAGATGCCAAGATGTACCC -3'
Posted On2015-10-08