Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Sort1'

351029

Institutional Source

Beutler Lab

Gene Symbol

Sort1

Ensembl Gene

ENSMUSG00000068747

Gene Name

sortilin 1

Synonyms

sortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.790) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108284082-108361511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108355541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 772 (T772S)

Ref Sequence

ENSEMBL: ENSMUSP00000123564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]

AlphaFold

Q6PHU5

Predicted Effect

probably benign
Transcript: ENSMUST00000102632

SMART Domains

Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	33	47	N/A	INTRINSIC
low complexity region	59	79	N/A	INTRINSIC
VPS10	131	743	N/A	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129755

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135636
AA Change: T772S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: T772S

Domain	Start	End	E-Value	Type
VPS10	1	218	2.3e-5	SMART
transmembrane domain	262	284	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Sort1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sort1	APN	3	108356307	missense	probably damaging	0.99
IGL01677:Sort1	APN	3	108344885	missense	probably benign	0.05
IGL02532:Sort1	APN	3	108325720	missense	probably benign	0.44
IGL03354:Sort1	APN	3	108348706	missense	probably benign	0.00
R0266:Sort1	UTSW	3	108344931	missense	probably benign	0.09
R0277:Sort1	UTSW	3	108324592	splice site	probably benign
R0559:Sort1	UTSW	3	108356579	missense	probably damaging	1.00
R0597:Sort1	UTSW	3	108338910	missense	probably damaging	1.00
R0624:Sort1	UTSW	3	108348630	missense	probably damaging	1.00
R1803:Sort1	UTSW	3	108325699	missense	probably damaging	1.00
R1872:Sort1	UTSW	3	108340695	missense	probably benign	0.01
R1986:Sort1	UTSW	3	108345727	missense	possibly damaging	0.71
R2130:Sort1	UTSW	3	108351686	missense	probably benign
R2131:Sort1	UTSW	3	108351686	missense	probably benign
R2133:Sort1	UTSW	3	108351686	missense	probably benign
R2362:Sort1	UTSW	3	108346665	missense	possibly damaging	0.89
R3436:Sort1	UTSW	3	108337807	missense	probably damaging	1.00
R3548:Sort1	UTSW	3	108337909	missense	possibly damaging	0.83
R3700:Sort1	UTSW	3	108356639	nonsense	probably null
R4496:Sort1	UTSW	3	108310145	missense	probably benign	0.17
R4632:Sort1	UTSW	3	108346678	missense	probably damaging	1.00
R4749:Sort1	UTSW	3	108356323	nonsense	probably null
R4994:Sort1	UTSW	3	108328069	missense	probably damaging	0.99
R5187:Sort1	UTSW	3	108324676	missense	probably damaging	1.00
R5753:Sort1	UTSW	3	108345774	missense	probably damaging	1.00
R6019:Sort1	UTSW	3	108357233	missense	possibly damaging	0.77
R6262:Sort1	UTSW	3	108310211	missense	probably damaging	1.00
R7369:Sort1	UTSW	3	108351680	missense	probably damaging	1.00
R7484:Sort1	UTSW	3	108338825	missense	probably damaging	1.00
R7512:Sort1	UTSW	3	108326007	splice site	probably null
R8076:Sort1	UTSW	3	108338867	missense	probably damaging	1.00
R8222:Sort1	UTSW	3	108334635	missense	probably benign
R8871:Sort1	UTSW	3	108355571	critical splice donor site	probably null
R8894:Sort1	UTSW	3	108338912	missense	probably damaging	1.00
R9169:Sort1	UTSW	3	108340678	nonsense	probably null
Z1177:Sort1	UTSW	3	108284380	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACCCTGAAGGCAATGAGGG -3'
(R):5'- CCTAGAGGTTATGGGTGGAGC -3'

Sequencing Primer
(F):5'- CCCTGAAGGCAATGAGGGAAGAG -3'
(R):5'- AATGGGGTGTTGAATGGGTCTATTAC -3'

Posted On

2015-10-08