Incidental Mutation 'R4616:Sort1'
ID 351029
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Name sortilin 1
Synonyms Ntsr3, neurotensin receptor 3, Ntr3, sortilin, 2900053A11Rik
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 108191398-108268827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108262857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 772 (T772S)
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
AlphaFold Q6PHU5
Predicted Effect probably benign
Transcript: ENSMUST00000102632
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129755
Predicted Effect possibly damaging
Transcript: ENSMUST00000135636
AA Change: T772S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: T772S

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 C T 14: 103,292,781 (GRCm39) T435M probably benign Het
Adgrf5 T C 17: 43,763,331 (GRCm39) F1078L probably benign Het
Adh6a A T 3: 138,030,708 (GRCm39) N110I probably damaging Het
Aldh16a1 T C 7: 44,798,212 (GRCm39) probably benign Het
Aopep G A 13: 63,446,565 (GRCm39) E123K probably damaging Het
Arhgef17 A G 7: 100,531,692 (GRCm39) F1302S probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bpifa6 T C 2: 153,824,908 (GRCm39) S28P possibly damaging Het
C9 A G 15: 6,520,944 (GRCm39) D51G probably damaging Het
Cfb T A 17: 35,078,044 (GRCm39) H962L probably benign Het
Chn2 G A 6: 54,267,388 (GRCm39) M292I probably damaging Het
Clec16a T A 16: 10,462,747 (GRCm39) probably null Het
Cyp1a1 T C 9: 57,609,039 (GRCm39) S307P probably benign Het
Dsg3 T C 18: 20,664,616 (GRCm39) V538A probably benign Het
Erbb3 G A 10: 128,408,639 (GRCm39) Q815* probably null Het
Fam90a1a C A 8: 22,453,862 (GRCm39) Q406K possibly damaging Het
Frmd3 T C 4: 74,106,109 (GRCm39) V585A probably benign Het
Gm8214 T C 1: 183,414,094 (GRCm39) noncoding transcript Het
Gpld1 G A 13: 25,168,799 (GRCm39) G771D probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Gria2 A T 3: 80,614,204 (GRCm39) I612N probably damaging Het
Ifit1bl1 T C 19: 34,572,010 (GRCm39) E149G probably damaging Het
Ighv1-82 T C 12: 115,916,280 (GRCm39) T77A probably benign Het
Ighv2-9 G T 12: 113,842,839 (GRCm39) T76K probably damaging Het
Igkv6-13 A T 6: 70,435,019 (GRCm39) M1K probably null Het
Igkv8-21 A T 6: 70,292,141 (GRCm39) S34T probably benign Het
Itpr1 A G 6: 108,458,184 (GRCm39) N1985D probably damaging Het
Jkampl A G 6: 73,446,252 (GRCm39) V99A probably benign Het
Lama3 T C 18: 12,637,454 (GRCm39) probably null Het
Lamc2 T C 1: 153,041,915 (GRCm39) Y73C probably damaging Het
Maff A G 15: 79,241,898 (GRCm39) D105G probably damaging Het
Mep1a C T 17: 43,797,132 (GRCm39) V312M possibly damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrgbp A T 2: 180,227,107 (GRCm39) silent Het
Mtmr4 T C 11: 87,501,761 (GRCm39) L548S probably damaging Het
Myo7b T C 18: 32,136,540 (GRCm39) probably null Het
Myo9a T C 9: 59,728,932 (GRCm39) I596T probably damaging Het
Or2f1b G T 6: 42,739,352 (GRCm39) R122L probably benign Het
Or52e3 C T 7: 102,869,629 (GRCm39) R235* probably null Het
Pcsk5 T G 19: 17,538,114 (GRCm39) Q904H probably benign Het
Pdzrn3 G T 6: 101,128,970 (GRCm39) H565Q probably damaging Het
Phkg2 C T 7: 127,176,792 (GRCm39) R61W probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Pomgnt1 T A 4: 116,012,087 (GRCm39) I337N probably damaging Het
Psmd3 T C 11: 98,573,752 (GRCm39) V66A probably benign Het
Ptger3 T C 3: 157,272,931 (GRCm39) S93P probably damaging Het
Rbm27 T A 18: 42,434,840 (GRCm39) D301E probably damaging Het
Rdh16 A T 10: 127,637,382 (GRCm39) probably null Het
Slc35a5 A T 16: 44,964,655 (GRCm39) F193I probably benign Het
Slc4a4 A G 5: 89,186,420 (GRCm39) K167R probably damaging Het
Sptbn5 T A 2: 119,879,238 (GRCm39) noncoding transcript Het
Stard5 G T 7: 83,282,489 (GRCm39) probably benign Het
Tbc1d22a A G 15: 86,119,886 (GRCm39) T61A probably damaging Het
Tox2 T C 2: 163,162,567 (GRCm39) L479P probably damaging Het
Usp53 A T 3: 122,752,769 (GRCm39) M80K probably damaging Het
Vmn1r209 A T 13: 22,990,135 (GRCm39) L185Q probably damaging Het
Vmn2r59 A G 7: 41,661,862 (GRCm39) I651T probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Zfhx4 T C 3: 5,478,127 (GRCm39) S3556P possibly damaging Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108,263,623 (GRCm39) missense probably damaging 0.99
IGL01677:Sort1 APN 3 108,252,201 (GRCm39) missense probably benign 0.05
IGL02532:Sort1 APN 3 108,233,036 (GRCm39) missense probably benign 0.44
IGL03354:Sort1 APN 3 108,256,022 (GRCm39) missense probably benign 0.00
R0266:Sort1 UTSW 3 108,252,247 (GRCm39) missense probably benign 0.09
R0277:Sort1 UTSW 3 108,231,908 (GRCm39) splice site probably benign
R0559:Sort1 UTSW 3 108,263,895 (GRCm39) missense probably damaging 1.00
R0597:Sort1 UTSW 3 108,246,226 (GRCm39) missense probably damaging 1.00
R0624:Sort1 UTSW 3 108,255,946 (GRCm39) missense probably damaging 1.00
R1803:Sort1 UTSW 3 108,233,015 (GRCm39) missense probably damaging 1.00
R1872:Sort1 UTSW 3 108,248,011 (GRCm39) missense probably benign 0.01
R1986:Sort1 UTSW 3 108,253,043 (GRCm39) missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108,259,002 (GRCm39) missense probably benign
R2131:Sort1 UTSW 3 108,259,002 (GRCm39) missense probably benign
R2133:Sort1 UTSW 3 108,259,002 (GRCm39) missense probably benign
R2362:Sort1 UTSW 3 108,253,981 (GRCm39) missense possibly damaging 0.89
R3436:Sort1 UTSW 3 108,245,123 (GRCm39) missense probably damaging 1.00
R3548:Sort1 UTSW 3 108,245,225 (GRCm39) missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108,263,955 (GRCm39) nonsense probably null
R4496:Sort1 UTSW 3 108,217,461 (GRCm39) missense probably benign 0.17
R4632:Sort1 UTSW 3 108,253,994 (GRCm39) missense probably damaging 1.00
R4749:Sort1 UTSW 3 108,263,639 (GRCm39) nonsense probably null
R4994:Sort1 UTSW 3 108,235,385 (GRCm39) missense probably damaging 0.99
R5187:Sort1 UTSW 3 108,231,992 (GRCm39) missense probably damaging 1.00
R5753:Sort1 UTSW 3 108,253,090 (GRCm39) missense probably damaging 1.00
R6019:Sort1 UTSW 3 108,264,549 (GRCm39) missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108,217,527 (GRCm39) missense probably damaging 1.00
R7369:Sort1 UTSW 3 108,258,996 (GRCm39) missense probably damaging 1.00
R7484:Sort1 UTSW 3 108,246,141 (GRCm39) missense probably damaging 1.00
R7512:Sort1 UTSW 3 108,233,323 (GRCm39) splice site probably null
R8076:Sort1 UTSW 3 108,246,183 (GRCm39) missense probably damaging 1.00
R8222:Sort1 UTSW 3 108,241,951 (GRCm39) missense probably benign
R8871:Sort1 UTSW 3 108,262,887 (GRCm39) critical splice donor site probably null
R8894:Sort1 UTSW 3 108,246,228 (GRCm39) missense probably damaging 1.00
R9169:Sort1 UTSW 3 108,247,994 (GRCm39) nonsense probably null
Z1177:Sort1 UTSW 3 108,191,696 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCCTGAAGGCAATGAGGG -3'
(R):5'- CCTAGAGGTTATGGGTGGAGC -3'

Sequencing Primer
(F):5'- CCCTGAAGGCAATGAGGGAAGAG -3'
(R):5'- AATGGGGTGTTGAATGGGTCTATTAC -3'
Posted On 2015-10-08