Incidental Mutation 'R4616:Pomgnt1'
ID 351034
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Name protein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms 0610016I07Rik, 4930467B06Rik
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 116007700-116017041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116012087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 337 (I337N)
Ref Sequence ENSEMBL: ENSMUSP00000112911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]
AlphaFold Q91X88
Predicted Effect probably damaging
Transcript: ENSMUST00000106494
AA Change: I315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700
AA Change: I315N

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
PDB:2YOQ|C 106 195 6e-10 PDB
Pfam:GNT-I 271 591 3e-52 PFAM
low complexity region 623 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106496
AA Change: I304N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700
AA Change: I304N

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOP|C 129 217 5e-10 PDB
Pfam:GNT-I 260 580 2.9e-52 PFAM
low complexity region 612 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106498
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700
AA Change: I337N

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120083
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700
AA Change: I337N

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121052
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700
AA Change: I337N

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155718
Meta Mutation Damage Score 0.9291 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 C T 14: 103,292,781 (GRCm39) T435M probably benign Het
Adgrf5 T C 17: 43,763,331 (GRCm39) F1078L probably benign Het
Adh6a A T 3: 138,030,708 (GRCm39) N110I probably damaging Het
Aldh16a1 T C 7: 44,798,212 (GRCm39) probably benign Het
Aopep G A 13: 63,446,565 (GRCm39) E123K probably damaging Het
Arhgef17 A G 7: 100,531,692 (GRCm39) F1302S probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bpifa6 T C 2: 153,824,908 (GRCm39) S28P possibly damaging Het
C9 A G 15: 6,520,944 (GRCm39) D51G probably damaging Het
Cfb T A 17: 35,078,044 (GRCm39) H962L probably benign Het
Chn2 G A 6: 54,267,388 (GRCm39) M292I probably damaging Het
Clec16a T A 16: 10,462,747 (GRCm39) probably null Het
Cyp1a1 T C 9: 57,609,039 (GRCm39) S307P probably benign Het
Dsg3 T C 18: 20,664,616 (GRCm39) V538A probably benign Het
Erbb3 G A 10: 128,408,639 (GRCm39) Q815* probably null Het
Fam90a1a C A 8: 22,453,862 (GRCm39) Q406K possibly damaging Het
Frmd3 T C 4: 74,106,109 (GRCm39) V585A probably benign Het
Gm8214 T C 1: 183,414,094 (GRCm39) noncoding transcript Het
Gpld1 G A 13: 25,168,799 (GRCm39) G771D probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Gria2 A T 3: 80,614,204 (GRCm39) I612N probably damaging Het
Ifit1bl1 T C 19: 34,572,010 (GRCm39) E149G probably damaging Het
Ighv1-82 T C 12: 115,916,280 (GRCm39) T77A probably benign Het
Ighv2-9 G T 12: 113,842,839 (GRCm39) T76K probably damaging Het
Igkv6-13 A T 6: 70,435,019 (GRCm39) M1K probably null Het
Igkv8-21 A T 6: 70,292,141 (GRCm39) S34T probably benign Het
Itpr1 A G 6: 108,458,184 (GRCm39) N1985D probably damaging Het
Jkampl A G 6: 73,446,252 (GRCm39) V99A probably benign Het
Lama3 T C 18: 12,637,454 (GRCm39) probably null Het
Lamc2 T C 1: 153,041,915 (GRCm39) Y73C probably damaging Het
Maff A G 15: 79,241,898 (GRCm39) D105G probably damaging Het
Mep1a C T 17: 43,797,132 (GRCm39) V312M possibly damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrgbp A T 2: 180,227,107 (GRCm39) silent Het
Mtmr4 T C 11: 87,501,761 (GRCm39) L548S probably damaging Het
Myo7b T C 18: 32,136,540 (GRCm39) probably null Het
Myo9a T C 9: 59,728,932 (GRCm39) I596T probably damaging Het
Or2f1b G T 6: 42,739,352 (GRCm39) R122L probably benign Het
Or52e3 C T 7: 102,869,629 (GRCm39) R235* probably null Het
Pcsk5 T G 19: 17,538,114 (GRCm39) Q904H probably benign Het
Pdzrn3 G T 6: 101,128,970 (GRCm39) H565Q probably damaging Het
Phkg2 C T 7: 127,176,792 (GRCm39) R61W probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Psmd3 T C 11: 98,573,752 (GRCm39) V66A probably benign Het
Ptger3 T C 3: 157,272,931 (GRCm39) S93P probably damaging Het
Rbm27 T A 18: 42,434,840 (GRCm39) D301E probably damaging Het
Rdh16 A T 10: 127,637,382 (GRCm39) probably null Het
Slc35a5 A T 16: 44,964,655 (GRCm39) F193I probably benign Het
Slc4a4 A G 5: 89,186,420 (GRCm39) K167R probably damaging Het
Sort1 A T 3: 108,262,857 (GRCm39) T772S possibly damaging Het
Sptbn5 T A 2: 119,879,238 (GRCm39) noncoding transcript Het
Stard5 G T 7: 83,282,489 (GRCm39) probably benign Het
Tbc1d22a A G 15: 86,119,886 (GRCm39) T61A probably damaging Het
Tox2 T C 2: 163,162,567 (GRCm39) L479P probably damaging Het
Usp53 A T 3: 122,752,769 (GRCm39) M80K probably damaging Het
Vmn1r209 A T 13: 22,990,135 (GRCm39) L185Q probably damaging Het
Vmn2r59 A G 7: 41,661,862 (GRCm39) I651T probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Zfhx4 T C 3: 5,478,127 (GRCm39) S3556P possibly damaging Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116,009,958 (GRCm39) missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116,010,105 (GRCm39) nonsense probably null
IGL02582:Pomgnt1 APN 4 116,015,747 (GRCm39) missense probably damaging 1.00
pomegranate UTSW 4 116,012,087 (GRCm39) missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116,015,757 (GRCm39) critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116,013,086 (GRCm39) missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116,009,382 (GRCm39) missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116,009,048 (GRCm39) missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116,012,472 (GRCm39) splice site probably null
R1983:Pomgnt1 UTSW 4 116,009,117 (GRCm39) missense probably benign 0.12
R1983:Pomgnt1 UTSW 4 116,009,066 (GRCm39) missense probably damaging 1.00
R2034:Pomgnt1 UTSW 4 116,015,124 (GRCm39) missense possibly damaging 0.87
R3721:Pomgnt1 UTSW 4 116,010,740 (GRCm39) splice site probably benign
R3774:Pomgnt1 UTSW 4 116,011,325 (GRCm39) missense probably damaging 1.00
R3775:Pomgnt1 UTSW 4 116,011,325 (GRCm39) missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116,011,139 (GRCm39) critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116,011,139 (GRCm39) critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116,011,139 (GRCm39) critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116,011,139 (GRCm39) critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116,010,120 (GRCm39) missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116,015,691 (GRCm39) missense probably benign 0.03
R4690:Pomgnt1 UTSW 4 116,012,707 (GRCm39) missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116,011,412 (GRCm39) missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116,012,972 (GRCm39) missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116,013,396 (GRCm39) missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116,013,453 (GRCm39) intron probably benign
R5569:Pomgnt1 UTSW 4 116,013,164 (GRCm39) missense probably damaging 1.00
R5821:Pomgnt1 UTSW 4 116,012,933 (GRCm39) missense probably benign 0.16
R5937:Pomgnt1 UTSW 4 116,011,110 (GRCm39) missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116,008,799 (GRCm39) missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116,011,080 (GRCm39) missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116,011,351 (GRCm39) missense probably damaging 0.97
R7503:Pomgnt1 UTSW 4 116,009,949 (GRCm39) missense possibly damaging 0.76
R7876:Pomgnt1 UTSW 4 116,015,106 (GRCm39) missense probably damaging 1.00
R8464:Pomgnt1 UTSW 4 116,009,348 (GRCm39) missense probably damaging 1.00
R9415:Pomgnt1 UTSW 4 116,013,378 (GRCm39) missense probably damaging 1.00
T0722:Pomgnt1 UTSW 4 115,994,624 (GRCm39) unclassified probably benign
T0975:Pomgnt1 UTSW 4 115,994,624 (GRCm39) unclassified probably benign
Z1177:Pomgnt1 UTSW 4 116,009,906 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTCGACTTCTTGTACGAGG -3'
(R):5'- CACATCCATTGGCTCCTGAG -3'

Sequencing Primer
(F):5'- TCTTGTACGAGGAACTATTAAAGGAG -3'
(R):5'- ATTGGCTCCTGAGGGCAC -3'
Posted On 2015-10-08