Mutagenetix > Incidental Mutations

Incidental Mutation 'R4616:Pomgnt1'

351034

Institutional Source

Beutler Lab

Gene Symbol

Pomgnt1

Ensembl Gene

ENSMUSG00000028700

Gene Name

protein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase

Synonyms

0610016I07Rik, 4930467B06Rik

MMRRC Submission

041827-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116123840-116159849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116154890 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 337 (I337N)

Ref Sequence

ENSEMBL: ENSMUSP00000112911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]

AlphaFold

Q91X88

Predicted Effect

probably damaging
Transcript: ENSMUST00000106494
AA Change: I315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700
AA Change: I315N

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
low complexity region	60	75	N/A	INTRINSIC
PDB:2YOQ\|C	106	195	6e-10	PDB
Pfam:GNT-I	271	591	3e-52	PFAM
low complexity region	623	636	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106496
AA Change: I304N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700
AA Change: I304N

Domain	Start	End	E-Value	Type
low complexity region	82	97	N/A	INTRINSIC
PDB:2YOP\|C	129	217	5e-10	PDB
Pfam:GNT-I	260	580	2.9e-52	PFAM
low complexity region	612	625	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106498
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700
AA Change: I337N

Domain	Start	End	E-Value	Type
low complexity region	82	97	N/A	INTRINSIC
PDB:2YOQ\|C	129	217	6e-10	PDB
Pfam:GNT-I	293	613	3.2e-52	PFAM
low complexity region	645	658	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120083
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700
AA Change: I337N

Domain	Start	End	E-Value	Type
low complexity region	82	97	N/A	INTRINSIC
Pfam:ILEI	129	220	8.9e-28	PFAM
Pfam:GNT-I	293	612	1.9e-51	PFAM
low complexity region	645	658	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121052
AA Change: I337N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700
AA Change: I337N

Domain	Start	End	E-Value	Type
low complexity region	82	97	N/A	INTRINSIC
PDB:2YOQ\|C	129	217	6e-10	PDB
Pfam:GNT-I	293	613	3.2e-52	PFAM
low complexity region	645	658	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133838

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136855

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155718

Meta Mutation Damage Score

0.9291

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Pomgnt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pomgnt1	APN	4	116152761	missense	probably damaging	1.00
IGL02001:Pomgnt1	APN	4	116152908	nonsense	probably null
IGL02582:Pomgnt1	APN	4	116158550	missense	probably damaging	1.00
pomegranate	UTSW	4	116154890	missense	probably damaging	1.00
R0206:Pomgnt1	UTSW	4	116158560	critical splice donor site	probably null
R0688:Pomgnt1	UTSW	4	116155889	missense	probably damaging	1.00
R0890:Pomgnt1	UTSW	4	116152185	missense	probably benign	0.25
R0927:Pomgnt1	UTSW	4	116151851	missense	probably damaging	1.00
R1942:Pomgnt1	UTSW	4	116155275	splice site	probably null
R1983:Pomgnt1	UTSW	4	116151869	missense	probably damaging	1.00
R1983:Pomgnt1	UTSW	4	116151920	missense	probably benign	0.12
R2034:Pomgnt1	UTSW	4	116157927	missense	possibly damaging	0.87
R3721:Pomgnt1	UTSW	4	116153543	splice site	probably benign
R3774:Pomgnt1	UTSW	4	116154128	missense	probably damaging	1.00
R3775:Pomgnt1	UTSW	4	116154128	missense	probably damaging	1.00
R3815:Pomgnt1	UTSW	4	116153942	critical splice donor site	probably null
R3816:Pomgnt1	UTSW	4	116153942	critical splice donor site	probably null
R3817:Pomgnt1	UTSW	4	116153942	critical splice donor site	probably null
R3818:Pomgnt1	UTSW	4	116153942	critical splice donor site	probably null
R4447:Pomgnt1	UTSW	4	116152923	missense	possibly damaging	0.75
R4583:Pomgnt1	UTSW	4	116158494	missense	probably benign	0.03
R4690:Pomgnt1	UTSW	4	116155510	missense	probably damaging	1.00
R4717:Pomgnt1	UTSW	4	116154215	missense	possibly damaging	0.50
R4719:Pomgnt1	UTSW	4	116155775	missense	probably damaging	1.00
R4747:Pomgnt1	UTSW	4	116156199	missense	probably damaging	1.00
R5108:Pomgnt1	UTSW	4	116156256	intron	probably benign
R5569:Pomgnt1	UTSW	4	116155967	missense	probably damaging	1.00
R5821:Pomgnt1	UTSW	4	116155736	missense	probably benign	0.16
R5937:Pomgnt1	UTSW	4	116153913	missense	probably benign	0.01
R6052:Pomgnt1	UTSW	4	116151602	missense	possibly damaging	0.91
R6745:Pomgnt1	UTSW	4	116153883	missense	probably damaging	0.97
R6949:Pomgnt1	UTSW	4	116154154	missense	probably damaging	0.97
R7503:Pomgnt1	UTSW	4	116152752	missense	possibly damaging	0.76
R7876:Pomgnt1	UTSW	4	116157909	missense	probably damaging	1.00
R8464:Pomgnt1	UTSW	4	116152151	missense	probably damaging	1.00
R9415:Pomgnt1	UTSW	4	116156181	missense	probably damaging	1.00
T0722:Pomgnt1	UTSW	4	116137427	unclassified	probably benign
T0975:Pomgnt1	UTSW	4	116137427	unclassified	probably benign
Z1177:Pomgnt1	UTSW	4	116152709	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGCTCGACTTCTTGTACGAGG -3'
(R):5'- CACATCCATTGGCTCCTGAG -3'

Sequencing Primer
(F):5'- TCTTGTACGAGGAACTATTAAAGGAG -3'
(R):5'- ATTGGCTCCTGAGGGCAC -3'

Posted On

2015-10-08