Mutagenetix > Incidental Mutations

Incidental Mutation 'R4616:Slc4a4'

351036

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

041827-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89038561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 167 (K167R)

Ref Sequence

ENSEMBL: ENSMUSP00000121744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113216] [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000134303] [ENSMUST00000148750] [ENSMUST00000156238]

AlphaFold

O88343

Predicted Effect

probably damaging
Transcript: ENSMUST00000113216
AA Change: K123R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108842
Gene: ENSMUSG00000060961
AA Change: K123R

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	149	4.2e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113218
AA Change: K167R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: K167R

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130041
AA Change: K123R

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: K123R

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134303
AA Change: K123R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119976
Gene: ENSMUSG00000060961
AA Change: K123R

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	233	1.4e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148750
AA Change: K167R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: K167R

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: K167R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: K167R

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0894

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
Therapod	UTSW	5	89135722	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
R8735:Slc4a4	UTSW	5	89132442	missense	probably damaging	1.00
R8786:Slc4a4	UTSW	5	89084690	missense	probably benign	0.07
R8968:Slc4a4	UTSW	5	89084653	missense	probably benign
R9014:Slc4a4	UTSW	5	89132386	missense	probably damaging	1.00
R9031:Slc4a4	UTSW	5	89057709	intron	probably benign
R9195:Slc4a4	UTSW	5	89133196	missense	possibly damaging	0.82
R9236:Slc4a4	UTSW	5	89046299	nonsense	probably null
R9261:Slc4a4	UTSW	5	89199709	missense	probably damaging	1.00
R9325:Slc4a4	UTSW	5	89228897	missense	probably damaging	1.00
R9401:Slc4a4	UTSW	5	89179666	missense	probably damaging	1.00
R9457:Slc4a4	UTSW	5	89214573	missense	probably damaging	1.00
R9462:Slc4a4	UTSW	5	89046272	missense	probably damaging	1.00
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTATGAAAGTGCTGGTCAGGG -3'
(R):5'- TTTCATGACACAAGCCTCTAAGAAC -3'

Sequencing Primer
(F):5'- TCAGAGCTGCTTTCAGGGAAG -3'
(R):5'- GCCTCTAAGAACCTGTGTTTTAGAG -3'

Posted On

2015-10-08