Incidental Mutation 'R4616:Chn2'
ID 351038
Institutional Source Beutler Lab
Gene Symbol Chn2
Ensembl Gene ENSMUSG00000004633
Gene Name chimerin 2
Synonyms 4930557O16Rik, 1700026N20Rik
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 54039554-54301810 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54290403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 292 (M292I)
Ref Sequence ENSEMBL: ENSMUSP00000035908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046856] [ENSMUST00000067741] [ENSMUST00000114401] [ENSMUST00000114402] [ENSMUST00000146114] [ENSMUST00000203091] [ENSMUST00000203941] [ENSMUST00000204115] [ENSMUST00000204746] [ENSMUST00000204921]
AlphaFold Q80XD1
Predicted Effect probably damaging
Transcript: ENSMUST00000046856
AA Change: M292I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035908
Gene: ENSMUSG00000004633
AA Change: M292I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SH2 57 136 7.23e-16 SMART
C1 215 264 1.88e-15 SMART
RhoGAP 288 465 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067741
AA Change: M156I

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066078
Gene: ENSMUSG00000004633
AA Change: M156I

DomainStartEndE-ValueType
C1 79 128 1.88e-15 SMART
RhoGAP 152 329 2.73e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114401
AA Change: M101I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110043
Gene: ENSMUSG00000004633
AA Change: M101I

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 274 2.73e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114402
AA Change: M101I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110044
Gene: ENSMUSG00000004633
AA Change: M101I

DomainStartEndE-ValueType
C1 24 73 1.88e-15 SMART
RhoGAP 97 224 2.07e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145111
Predicted Effect probably benign
Transcript: ENSMUST00000146114
AA Change: M106I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114476
Gene: ENSMUSG00000004633
AA Change: M106I

DomainStartEndE-ValueType
C1 29 78 1.88e-15 SMART
RhoGAP 102 279 2.73e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203091
AA Change: M156I

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145008
Gene: ENSMUSG00000004633
AA Change: M156I

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
Pfam:RhoGAP 155 196 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203941
SMART Domains Protein: ENSMUSP00000145314
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 225 1.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204115
AA Change: M156I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145507
Gene: ENSMUSG00000004633
AA Change: M156I

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 101 257 3.7e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204746
SMART Domains Protein: ENSMUSP00000144983
Gene: ENSMUSG00000004633

DomainStartEndE-ValueType
RhoGAP 101 271 4.7e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204921
AA Change: M156I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145231
Gene: ENSMUSG00000004633
AA Change: M156I

DomainStartEndE-ValueType
C1 79 128 9.1e-18 SMART
RhoGAP 152 283 4.9e-37 SMART
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired infrapyramidal tract neuron prunning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Chn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chn2 APN 6 54295922 critical splice donor site probably null
IGL02158:Chn2 APN 6 54300245 unclassified probably benign
IGL02618:Chn2 APN 6 54220437 missense probably damaging 1.00
IGL02807:Chn2 APN 6 54295913 missense possibly damaging 0.80
IGL03357:Chn2 APN 6 54194077 missense probably benign 0.02
R0002:Chn2 UTSW 6 54273113 missense probably benign 0.08
R0123:Chn2 UTSW 6 54290451 splice site probably benign
R0225:Chn2 UTSW 6 54290451 splice site probably benign
R1478:Chn2 UTSW 6 54293080 missense probably damaging 1.00
R1905:Chn2 UTSW 6 54286121 missense probably damaging 1.00
R3769:Chn2 UTSW 6 54290411 missense probably damaging 1.00
R3946:Chn2 UTSW 6 54269426 unclassified probably benign
R4125:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4127:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4128:Chn2 UTSW 6 54272978 missense probably damaging 1.00
R4614:Chn2 UTSW 6 54290403 missense probably damaging 1.00
R5063:Chn2 UTSW 6 54290287 nonsense probably null
R5121:Chn2 UTSW 6 54218561 missense possibly damaging 0.57
R5208:Chn2 UTSW 6 54295801 missense probably damaging 0.97
R5240:Chn2 UTSW 6 54220695 missense probably benign
R5348:Chn2 UTSW 6 54300218 missense probably damaging 0.99
R5861:Chn2 UTSW 6 54290374 missense probably damaging 1.00
R6539:Chn2 UTSW 6 54173461 splice site probably null
R6824:Chn2 UTSW 6 54272953 missense probably benign 0.00
R7194:Chn2 UTSW 6 54286177 splice site probably null
R7740:Chn2 UTSW 6 54300171 missense probably benign 0.18
R7765:Chn2 UTSW 6 54298152 critical splice donor site probably null
R7997:Chn2 UTSW 6 54290285 missense probably damaging 1.00
R8477:Chn2 UTSW 6 54269482 splice site probably null
R8804:Chn2 UTSW 6 54273076 missense probably benign 0.01
R9297:Chn2 UTSW 6 54295855 missense probably damaging 1.00
R9318:Chn2 UTSW 6 54295855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGCAGCACATAGTTTGTC -3'
(R):5'- TGTGTATGCAAGCCATTGTCC -3'

Sequencing Primer
(F):5'- TTTGATGAAGGGACCCAGTGAC -3'
(R):5'- TGCAAGCCATTGTCCTAAAGG -3'
Posted On 2015-10-08