Mutagenetix > Incidental Mutations

Incidental Mutation 'R4616:Pdzrn3'

351041

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn3

Ensembl Gene

ENSMUSG00000035357

Gene Name

PDZ domain containing RING finger 3

Synonyms

LNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik

MMRRC Submission

041827-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.711) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101149609-101377897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101152009 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 565 (H565Q)

Ref Sequence

ENSEMBL: ENSMUSP00000075376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075994]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075994
AA Change: H565Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: H565Q

Domain	Start	End	E-Value	Type
RING	18	55	3.93e-3	SMART
low complexity region	198	214	N/A	INTRINSIC
PDZ	257	339	3.38e-21	SMART
PDZ	429	504	3.86e-16	SMART
low complexity region	512	526	N/A	INTRINSIC
low complexity region	660	671	N/A	INTRINSIC
low complexity region	1020	1029	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204522

Meta Mutation Damage Score

0.0745

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Pdzrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Pdzrn3	APN	6	101354486	missense	probably benign	0.01
IGL01511:Pdzrn3	APN	6	101153256	missense	possibly damaging	0.66
IGL01554:Pdzrn3	APN	6	101150541	missense	probably damaging	1.00
IGL02450:Pdzrn3	APN	6	101354500	missense	probably damaging	1.00
IGL02505:Pdzrn3	APN	6	101151938	missense	possibly damaging	0.94
IGL03061:Pdzrn3	APN	6	101151855	missense	probably damaging	1.00
IGL03210:Pdzrn3	APN	6	101156952	missense	possibly damaging	0.95
gefilte	UTSW	6	101154192	critical splice donor site	probably null
implevit_bonis	UTSW	6	101151022	missense	probably benign	0.15
predisposition	UTSW	6	101151053	missense	probably damaging	1.00
tendency	UTSW	6	101151428	missense	probably damaging	1.00
PIT4581001:Pdzrn3	UTSW	6	101151503	missense	probably benign	0.00
R0110:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0469:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0496:Pdzrn3	UTSW	6	101150570	missense	possibly damaging	0.94
R0510:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0883:Pdzrn3	UTSW	6	101155942	splice site	probably null
R1171:Pdzrn3	UTSW	6	101150877	missense	probably damaging	1.00
R1471:Pdzrn3	UTSW	6	101151512	missense	possibly damaging	0.77
R1496:Pdzrn3	UTSW	6	101150969	missense	probably benign	0.00
R1596:Pdzrn3	UTSW	6	101151005	missense	probably benign	0.03
R2033:Pdzrn3	UTSW	6	101150954	missense	probably damaging	1.00
R2068:Pdzrn3	UTSW	6	101150699	missense	probably damaging	1.00
R2084:Pdzrn3	UTSW	6	101154295	missense	probably benign	0.35
R2432:Pdzrn3	UTSW	6	101150791	missense	probably damaging	1.00
R3727:Pdzrn3	UTSW	6	101156945	missense	probably damaging	0.98
R3861:Pdzrn3	UTSW	6	101172371	missense	possibly damaging	0.95
R4967:Pdzrn3	UTSW	6	101151590	missense	probably damaging	1.00
R5224:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5226:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5227:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5230:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5320:Pdzrn3	UTSW	6	101151103	missense	probably damaging	1.00
R5414:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5686:Pdzrn3	UTSW	6	101151428	missense	probably damaging	1.00
R5772:Pdzrn3	UTSW	6	101172314	missense	probably benign	0.00
R6026:Pdzrn3	UTSW	6	101362144	missense	probably benign	0.40
R6213:Pdzrn3	UTSW	6	101377844	missense	probably damaging	1.00
R6518:Pdzrn3	UTSW	6	101150514	makesense	probably null
R6657:Pdzrn3	UTSW	6	101151022	missense	probably benign	0.15
R6951:Pdzrn3	UTSW	6	101154192	critical splice donor site	probably null
R7055:Pdzrn3	UTSW	6	101151774	nonsense	probably null
R7290:Pdzrn3	UTSW	6	101151245	missense	probably benign
R7608:Pdzrn3	UTSW	6	101151752	missense	probably damaging	1.00
R7834:Pdzrn3	UTSW	6	101151195	missense	probably damaging	0.97
R7917:Pdzrn3	UTSW	6	101151195	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CGCAGAGATGAAGGACTCATTG -3'
(R):5'- GCCAACCTTAGGAACTTAGAACTC -3'

Sequencing Primer
(F):5'- CTCATTGCTGAAAGGCAGGTC -3'
(R):5'- ACCTTAGGAACTTAGAACTCAATCC -3'

Posted On

2015-10-08