Incidental Mutation 'R4616:Aldh16a1'
ID 351043
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 44798212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000210125] [ENSMUST00000209963] [ENSMUST00000211362] [ENSMUST00000211169]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147416
AA Change: N131S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect probably benign
Transcript: ENSMUST00000209963
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 C T 14: 103,292,781 (GRCm39) T435M probably benign Het
Adgrf5 T C 17: 43,763,331 (GRCm39) F1078L probably benign Het
Adh6a A T 3: 138,030,708 (GRCm39) N110I probably damaging Het
Aopep G A 13: 63,446,565 (GRCm39) E123K probably damaging Het
Arhgef17 A G 7: 100,531,692 (GRCm39) F1302S probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bpifa6 T C 2: 153,824,908 (GRCm39) S28P possibly damaging Het
C9 A G 15: 6,520,944 (GRCm39) D51G probably damaging Het
Cfb T A 17: 35,078,044 (GRCm39) H962L probably benign Het
Chn2 G A 6: 54,267,388 (GRCm39) M292I probably damaging Het
Clec16a T A 16: 10,462,747 (GRCm39) probably null Het
Cyp1a1 T C 9: 57,609,039 (GRCm39) S307P probably benign Het
Dsg3 T C 18: 20,664,616 (GRCm39) V538A probably benign Het
Erbb3 G A 10: 128,408,639 (GRCm39) Q815* probably null Het
Fam90a1a C A 8: 22,453,862 (GRCm39) Q406K possibly damaging Het
Frmd3 T C 4: 74,106,109 (GRCm39) V585A probably benign Het
Gm8214 T C 1: 183,414,094 (GRCm39) noncoding transcript Het
Gpld1 G A 13: 25,168,799 (GRCm39) G771D probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Gria2 A T 3: 80,614,204 (GRCm39) I612N probably damaging Het
Ifit1bl1 T C 19: 34,572,010 (GRCm39) E149G probably damaging Het
Ighv1-82 T C 12: 115,916,280 (GRCm39) T77A probably benign Het
Ighv2-9 G T 12: 113,842,839 (GRCm39) T76K probably damaging Het
Igkv6-13 A T 6: 70,435,019 (GRCm39) M1K probably null Het
Igkv8-21 A T 6: 70,292,141 (GRCm39) S34T probably benign Het
Itpr1 A G 6: 108,458,184 (GRCm39) N1985D probably damaging Het
Jkampl A G 6: 73,446,252 (GRCm39) V99A probably benign Het
Lama3 T C 18: 12,637,454 (GRCm39) probably null Het
Lamc2 T C 1: 153,041,915 (GRCm39) Y73C probably damaging Het
Maff A G 15: 79,241,898 (GRCm39) D105G probably damaging Het
Mep1a C T 17: 43,797,132 (GRCm39) V312M possibly damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrgbp A T 2: 180,227,107 (GRCm39) silent Het
Mtmr4 T C 11: 87,501,761 (GRCm39) L548S probably damaging Het
Myo7b T C 18: 32,136,540 (GRCm39) probably null Het
Myo9a T C 9: 59,728,932 (GRCm39) I596T probably damaging Het
Or2f1b G T 6: 42,739,352 (GRCm39) R122L probably benign Het
Or52e3 C T 7: 102,869,629 (GRCm39) R235* probably null Het
Pcsk5 T G 19: 17,538,114 (GRCm39) Q904H probably benign Het
Pdzrn3 G T 6: 101,128,970 (GRCm39) H565Q probably damaging Het
Phkg2 C T 7: 127,176,792 (GRCm39) R61W probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Pomgnt1 T A 4: 116,012,087 (GRCm39) I337N probably damaging Het
Psmd3 T C 11: 98,573,752 (GRCm39) V66A probably benign Het
Ptger3 T C 3: 157,272,931 (GRCm39) S93P probably damaging Het
Rbm27 T A 18: 42,434,840 (GRCm39) D301E probably damaging Het
Rdh16 A T 10: 127,637,382 (GRCm39) probably null Het
Slc35a5 A T 16: 44,964,655 (GRCm39) F193I probably benign Het
Slc4a4 A G 5: 89,186,420 (GRCm39) K167R probably damaging Het
Sort1 A T 3: 108,262,857 (GRCm39) T772S possibly damaging Het
Sptbn5 T A 2: 119,879,238 (GRCm39) noncoding transcript Het
Stard5 G T 7: 83,282,489 (GRCm39) probably benign Het
Tbc1d22a A G 15: 86,119,886 (GRCm39) T61A probably damaging Het
Tox2 T C 2: 163,162,567 (GRCm39) L479P probably damaging Het
Usp53 A T 3: 122,752,769 (GRCm39) M80K probably damaging Het
Vmn1r209 A T 13: 22,990,135 (GRCm39) L185Q probably damaging Het
Vmn2r59 A G 7: 41,661,862 (GRCm39) I651T probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Zfhx4 T C 3: 5,478,127 (GRCm39) S3556P possibly damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGTGTTGTCCCCGAGCA -3'
(R):5'- TTTCTCCTGAAGACAGTCTCAG -3'

Sequencing Primer
(F):5'- AGCTCCAGGGAGTTGGCTC -3'
(R):5'- CCTGTAAGTTCAGGTGCAGACAATC -3'
Posted On 2015-10-08