Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Arhgef17'

351045

Institutional Source

Beutler Lab

Gene Symbol

Arhgef17

Ensembl Gene

ENSMUSG00000032875

Gene Name

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100869752-100932107 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100882485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1302 (F1302S)

Ref Sequence

ENSEMBL: ENSMUSP00000102647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]

AlphaFold

Q80U35

Predicted Effect

probably damaging
Transcript: ENSMUST00000107032
AA Change: F1302S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: F1302S

Domain	Start	End	E-Value	Type
low complexity region	65	74	N/A	INTRINSIC
low complexity region	160	175	N/A	INTRINSIC
low complexity region	196	209	N/A	INTRINSIC
low complexity region	227	255	N/A	INTRINSIC
low complexity region	282	297	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC
low complexity region	507	526	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC
low complexity region	828	842	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
RhoGEF	1063	1246	9.56e-61	SMART
Blast:PH	1281	1466	4e-88	BLAST
low complexity region	1582	1595	N/A	INTRINSIC
low complexity region	1630	1642	N/A	INTRINSIC
low complexity region	1646	1657	N/A	INTRINSIC
low complexity region	1661	1701	N/A	INTRINSIC
low complexity region	1708	1719	N/A	INTRINSIC
low complexity region	2033	2040	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175555

Predicted Effect

probably benign
Transcript: ENSMUST00000208482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208735

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209041
AA Change: F293S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.9335

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Arhgef17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Arhgef17	APN	7	100929449	missense	probably benign
IGL01071:Arhgef17	APN	7	100885700	missense	probably damaging	0.99
IGL01882:Arhgef17	APN	7	100878580	nonsense	probably null
IGL01995:Arhgef17	APN	7	100928655	missense	probably benign	0.02
IGL02213:Arhgef17	APN	7	100890426	missense	probably benign
IGL02380:Arhgef17	APN	7	100929443	missense	possibly damaging	0.60
IGL02551:Arhgef17	APN	7	100930346	missense	probably damaging	1.00
IGL02613:Arhgef17	APN	7	100928896	missense	probably damaging	1.00
IGL02643:Arhgef17	APN	7	100883882	missense	possibly damaging	0.95
IGL02798:Arhgef17	APN	7	100929626	missense	probably benign	0.00
IGL03113:Arhgef17	APN	7	100929731	missense	probably benign	0.00
IGL03264:Arhgef17	APN	7	100880013	missense	probably benign	0.00
G1Funyon:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R0064:Arhgef17	UTSW	7	100881354	missense	probably benign	0.00
R0189:Arhgef17	UTSW	7	100928850	missense	probably damaging	1.00
R0482:Arhgef17	UTSW	7	100880621	missense	probably damaging	1.00
R0826:Arhgef17	UTSW	7	100930743	missense	probably benign	0.01
R1295:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1296:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1389:Arhgef17	UTSW	7	100931037	small deletion	probably benign
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1513:Arhgef17	UTSW	7	100930862	missense	probably benign
R1539:Arhgef17	UTSW	7	100890473	missense	probably damaging	1.00
R1644:Arhgef17	UTSW	7	100929504	missense	probably damaging	1.00
R1789:Arhgef17	UTSW	7	100929870	missense	probably damaging	1.00
R1861:Arhgef17	UTSW	7	100882268	missense	probably damaging	1.00
R1868:Arhgef17	UTSW	7	100878977	missense	probably benign
R2009:Arhgef17	UTSW	7	100881781	missense	probably damaging	0.98
R2095:Arhgef17	UTSW	7	100881263	missense	probably damaging	1.00
R2311:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35
R3607:Arhgef17	UTSW	7	100931172	missense	probably damaging	1.00
R3882:Arhgef17	UTSW	7	100876454	missense	possibly damaging	0.70
R4089:Arhgef17	UTSW	7	100883799	missense	probably damaging	1.00
R4420:Arhgef17	UTSW	7	100882308	splice site	probably benign
R4536:Arhgef17	UTSW	7	100929854	missense	probably damaging	1.00
R4548:Arhgef17	UTSW	7	100931129	missense	possibly damaging	0.60
R5040:Arhgef17	UTSW	7	100876825	missense	probably benign	0.17
R5100:Arhgef17	UTSW	7	100881756	missense	possibly damaging	0.90
R5233:Arhgef17	UTSW	7	100881369	missense	possibly damaging	0.61
R5307:Arhgef17	UTSW	7	100929428	missense	probably benign	0.00
R5313:Arhgef17	UTSW	7	100928924	missense	probably damaging	0.99
R5643:Arhgef17	UTSW	7	100880011	missense	probably damaging	1.00
R5704:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6166:Arhgef17	UTSW	7	100876492	missense	probably damaging	1.00
R6417:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6420:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6510:Arhgef17	UTSW	7	100878536	missense	probably damaging	0.97
R6877:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6888:Arhgef17	UTSW	7	100930820	missense	possibly damaging	0.74
R7016:Arhgef17	UTSW	7	100878977	missense	probably benign
R7073:Arhgef17	UTSW	7	100929991	nonsense	probably null
R7322:Arhgef17	UTSW	7	100877797	missense	probably benign	0.01
R7691:Arhgef17	UTSW	7	100929642	missense	probably damaging	1.00
R7724:Arhgef17	UTSW	7	100880609	missense	probably damaging	1.00
R7728:Arhgef17	UTSW	7	100930068	missense	probably benign	0.00
R7829:Arhgef17	UTSW	7	100876845	missense	probably benign	0.03
R8036:Arhgef17	UTSW	7	100929855	missense	probably damaging	1.00
R8072:Arhgef17	UTSW	7	100881797	missense	probably benign	0.04
R8301:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R8935:Arhgef17	UTSW	7	100878117	missense	probably benign	0.03
R8958:Arhgef17	UTSW	7	100929812	missense	probably damaging	0.98
R9221:Arhgef17	UTSW	7	100879611	missense	possibly damaging	0.78
R9362:Arhgef17	UTSW	7	100930958	missense	probably benign	0.12
R9499:Arhgef17	UTSW	7	100876895	missense	possibly damaging	0.52
R9593:Arhgef17	UTSW	7	100882802	missense	probably damaging	1.00
X0012:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TTGCTGGCTGTATCAATGACG -3'
(R):5'- AATGGGAGCCCTGCATGAATC -3'

Sequencing Primer
(F):5'- TATCAATGACGCTGGCTGC -3'
(R):5'- TGAATCCCGATTCCACATAAGTG -3'

Posted On

2015-10-08