Incidental Mutation 'R4616:Olfr594'
ID 351046
Institutional Source Beutler Lab
Gene Symbol Olfr594
Ensembl Gene ENSMUSG00000073954
Gene Name olfactory receptor 594
Synonyms GA_x6K02T2PBJ9-5935234-5936169, MOR32-10
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103216996-103222313 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 103220422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 235 (R235*)
Ref Sequence ENSEMBL: ENSMUSP00000149847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098205] [ENSMUST00000214051]
AlphaFold Q7TRR4
Predicted Effect probably null
Transcript: ENSMUST00000098205
AA Change: R235*
SMART Domains Protein: ENSMUSP00000095806
Gene: ENSMUSG00000073954
AA Change: R235*

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 2.6e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 284 4.6e-6 PFAM
Pfam:7tm_1 43 293 3.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214051
AA Change: R235*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Olfr594
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Olfr594 APN 7 103220351 missense probably damaging 1.00
IGL02732:Olfr594 APN 7 103220240 missense probably benign 0.01
IGL03268:Olfr594 APN 7 103220641 missense probably benign 0.09
R0008:Olfr594 UTSW 7 103220351 missense probably damaging 1.00
R0008:Olfr594 UTSW 7 103220377 missense probably benign 0.00
R1056:Olfr594 UTSW 7 103220418 missense probably benign 0.01
R1300:Olfr594 UTSW 7 103220117 missense probably benign 0.10
R1961:Olfr594 UTSW 7 103219997 missense probably benign
R2029:Olfr594 UTSW 7 103219760 missense probably damaging 0.97
R2380:Olfr594 UTSW 7 103220608 missense possibly damaging 0.93
R7361:Olfr594 UTSW 7 103220623 missense possibly damaging 0.96
R7366:Olfr594 UTSW 7 103220533 missense probably benign 0.02
R7539:Olfr594 UTSW 7 103220066 missense possibly damaging 0.93
R7593:Olfr594 UTSW 7 103220264 missense probably damaging 1.00
R8393:Olfr594 UTSW 7 103220192 missense probably benign 0.07
R8809:Olfr594 UTSW 7 103220239 missense probably benign
R8984:Olfr594 UTSW 7 103220186 missense possibly damaging 0.76
R9203:Olfr594 UTSW 7 103220655 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATACTACGGTTGCCCTTCTGTG -3'
(R):5'- TGGTTCGTACCCCATATATGAC -3'

Sequencing Primer
(F):5'- CCTTCTGTGGGAATAATGTCATTC -3'
(R):5'- CAGGATTAAGCATTGGTGGCACTAC -3'
Posted On 2015-10-08