Incidental Mutation 'R4616:Phkg2'
ID 351047
Institutional Source Beutler Lab
Gene Symbol Phkg2
Ensembl Gene ENSMUSG00000030815
Gene Name phosphorylase kinase, gamma 2 (testis)
Synonyms
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.482) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127573340-127583307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127577620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 61 (R61W)
Ref Sequence ENSEMBL: ENSMUSP00000145927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]
AlphaFold Q9DB30
Predicted Effect probably damaging
Transcript: ENSMUST00000033086
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121004
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138158
Predicted Effect probably damaging
Transcript: ENSMUST00000146383
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151908
Predicted Effect unknown
Transcript: ENSMUST00000154891
AA Change: R61W
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815
AA Change: R61W

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190938
Predicted Effect probably damaging
Transcript: ENSMUST00000205633
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206818
Meta Mutation Damage Score 0.2820 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Phkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Phkg2 APN 7 127582340 missense probably damaging 1.00
IGL02259:Phkg2 APN 7 127582286 intron probably benign
IGL02699:Phkg2 APN 7 127582550 missense probably benign
IGL03039:Phkg2 APN 7 127579694 nonsense probably null
R0326:Phkg2 UTSW 7 127573903 missense probably damaging 1.00
R2141:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2142:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2763:Phkg2 UTSW 7 127579833 missense probably benign 0.00
R4614:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4615:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4666:Phkg2 UTSW 7 127577984 missense possibly damaging 0.93
R4981:Phkg2 UTSW 7 127582379 missense probably damaging 1.00
R4993:Phkg2 UTSW 7 127573941 missense probably damaging 1.00
R5287:Phkg2 UTSW 7 127582757 frame shift probably null
R5416:Phkg2 UTSW 7 127582935 missense possibly damaging 0.46
R7276:Phkg2 UTSW 7 127582386 missense possibly damaging 0.80
R7655:Phkg2 UTSW 7 127582902 missense probably damaging 0.99
R7656:Phkg2 UTSW 7 127582902 missense probably damaging 0.99
R8504:Phkg2 UTSW 7 127582356 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTCGATGTGGTGGTGCACA -3'
(R):5'- GCAATTCTAGGGTGTGGGTCA -3'

Sequencing Primer
(F):5'- CACCCAGTCTTACAGGATGTGATG -3'
(R):5'- GTGGGTCATGAATAGGGCC -3'
Posted On 2015-10-08