Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Phkg2'

351047

Institutional Source

Beutler Lab

Gene Symbol

Phkg2

Ensembl Gene

ENSMUSG00000030815

Gene Name

phosphorylase kinase, gamma 2 (testis)

Synonyms

1500017I02Rik

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.550) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127172512-127182479 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127176792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 61 (R61W)

Ref Sequence

ENSEMBL: ENSMUSP00000145927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]

AlphaFold

Q9DB30

Predicted Effect

probably damaging
Transcript: ENSMUST00000033086
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: R61W

Domain	Start	End	E-Value	Type
S_TKc	24	291	6.4e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072155

SMART Domains

Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

Domain	Start	End	E-Value	Type
Pfam:CLAMP	130	228	3.1e-37	PFAM
low complexity region	243	274	N/A	INTRINSIC
coiled coil region	285	319	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121004
AA Change: R61W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: R61W

Domain	Start	End	E-Value	Type
S_TKc	24	291	6.4e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129457

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133621

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138158

Predicted Effect

probably damaging
Transcript: ENSMUST00000146383
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815
AA Change: R61W

Domain	Start	End	E-Value	Type
Pfam:Pkinase	24	85	8.6e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000154891
AA Change: R61W

SMART Domains

Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815
AA Change: R61W

Domain	Start	End	E-Value	Type
Pfam:Pkinase	24	78	4.5e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000205633
AA Change: R61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151908

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190938

Predicted Effect

probably benign
Transcript: ENSMUST00000206818

Meta Mutation Damage Score

0.2820

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	C	T	14: 103,292,781 (GRCm39)	T435M	probably benign	Het
Adgrf5	T	C	17: 43,763,331 (GRCm39)	F1078L	probably benign	Het
Adh6a	A	T	3: 138,030,708 (GRCm39)	N110I	probably damaging	Het
Aldh16a1	T	C	7: 44,798,212 (GRCm39)		probably benign	Het
Aopep	G	A	13: 63,446,565 (GRCm39)	E123K	probably damaging	Het
Arhgef17	A	G	7: 100,531,692 (GRCm39)	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,839,506 (GRCm39)	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,824,908 (GRCm39)	S28P	possibly damaging	Het
C9	A	G	15: 6,520,944 (GRCm39)	D51G	probably damaging	Het
Cfb	T	A	17: 35,078,044 (GRCm39)	H962L	probably benign	Het
Chn2	G	A	6: 54,267,388 (GRCm39)	M292I	probably damaging	Het
Clec16a	T	A	16: 10,462,747 (GRCm39)		probably null	Het
Cyp1a1	T	C	9: 57,609,039 (GRCm39)	S307P	probably benign	Het
Dsg3	T	C	18: 20,664,616 (GRCm39)	V538A	probably benign	Het
Erbb3	G	A	10: 128,408,639 (GRCm39)	Q815*	probably null	Het
Fam90a1a	C	A	8: 22,453,862 (GRCm39)	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,106,109 (GRCm39)	V585A	probably benign	Het
Gm8214	T	C	1: 183,414,094 (GRCm39)		noncoding transcript	Het
Gpld1	G	A	13: 25,168,799 (GRCm39)	G771D	probably damaging	Het
Gpr20	T	C	15: 73,567,585 (GRCm39)	N268S	probably benign	Het
Gria2	A	T	3: 80,614,204 (GRCm39)	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,572,010 (GRCm39)	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,916,280 (GRCm39)	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,842,839 (GRCm39)	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,435,019 (GRCm39)	M1K	probably null	Het
Igkv8-21	A	T	6: 70,292,141 (GRCm39)	S34T	probably benign	Het
Itpr1	A	G	6: 108,458,184 (GRCm39)	N1985D	probably damaging	Het
Jkampl	A	G	6: 73,446,252 (GRCm39)	V99A	probably benign	Het
Lama3	T	C	18: 12,637,454 (GRCm39)		probably null	Het
Lamc2	T	C	1: 153,041,915 (GRCm39)	Y73C	probably damaging	Het
Maff	A	G	15: 79,241,898 (GRCm39)	D105G	probably damaging	Het
Mep1a	C	T	17: 43,797,132 (GRCm39)	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,376,335 (GRCm39)		probably benign	Het
Mplkipl1	C	T	19: 61,164,364 (GRCm39)	G24R	unknown	Het
Mrgbp	A	T	2: 180,227,107 (GRCm39)		silent	Het
Mtmr4	T	C	11: 87,501,761 (GRCm39)	L548S	probably damaging	Het
Myo7b	T	C	18: 32,136,540 (GRCm39)		probably null	Het
Myo9a	T	C	9: 59,728,932 (GRCm39)	I596T	probably damaging	Het
Or2f1b	G	T	6: 42,739,352 (GRCm39)	R122L	probably benign	Het
Or52e3	C	T	7: 102,869,629 (GRCm39)	R235*	probably null	Het
Pcsk5	T	G	19: 17,538,114 (GRCm39)	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,128,970 (GRCm39)	H565Q	probably damaging	Het
Pkd2l1	C	A	19: 44,142,573 (GRCm39)	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,012,087 (GRCm39)	I337N	probably damaging	Het
Psmd3	T	C	11: 98,573,752 (GRCm39)	V66A	probably benign	Het
Ptger3	T	C	3: 157,272,931 (GRCm39)	S93P	probably damaging	Het
Rbm27	T	A	18: 42,434,840 (GRCm39)	D301E	probably damaging	Het
Rdh16	A	T	10: 127,637,382 (GRCm39)		probably null	Het
Slc35a5	A	T	16: 44,964,655 (GRCm39)	F193I	probably benign	Het
Slc4a4	A	G	5: 89,186,420 (GRCm39)	K167R	probably damaging	Het
Sort1	A	T	3: 108,262,857 (GRCm39)	T772S	possibly damaging	Het
Sptbn5	T	A	2: 119,879,238 (GRCm39)		noncoding transcript	Het
Stard5	G	T	7: 83,282,489 (GRCm39)		probably benign	Het
Tbc1d22a	A	G	15: 86,119,886 (GRCm39)	T61A	probably damaging	Het
Tox2	T	C	2: 163,162,567 (GRCm39)	L479P	probably damaging	Het
Usp53	A	T	3: 122,752,769 (GRCm39)	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,990,135 (GRCm39)	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 41,661,862 (GRCm39)	I651T	probably benign	Het
Vsig1	G	T	X: 139,827,135 (GRCm39)	A95S	probably benign	Het
Zfhx4	T	C	3: 5,478,127 (GRCm39)	S3556P	possibly damaging	Het

Other mutations in Phkg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01953:Phkg2	APN	7	127,181,512 (GRCm39)	missense	probably damaging	1.00
IGL02259:Phkg2	APN	7	127,181,458 (GRCm39)	intron	probably benign
IGL02699:Phkg2	APN	7	127,181,722 (GRCm39)	missense	probably benign
IGL03039:Phkg2	APN	7	127,178,866 (GRCm39)	nonsense	probably null
R0326:Phkg2	UTSW	7	127,173,075 (GRCm39)	missense	probably damaging	1.00
R2141:Phkg2	UTSW	7	127,181,386 (GRCm39)	critical splice donor site	probably null
R2142:Phkg2	UTSW	7	127,181,386 (GRCm39)	critical splice donor site	probably null
R2763:Phkg2	UTSW	7	127,179,005 (GRCm39)	missense	probably benign	0.00
R4614:Phkg2	UTSW	7	127,176,792 (GRCm39)	missense	probably damaging	1.00
R4615:Phkg2	UTSW	7	127,176,792 (GRCm39)	missense	probably damaging	1.00
R4666:Phkg2	UTSW	7	127,177,156 (GRCm39)	missense	possibly damaging	0.93
R4981:Phkg2	UTSW	7	127,181,551 (GRCm39)	missense	probably damaging	1.00
R4993:Phkg2	UTSW	7	127,173,113 (GRCm39)	missense	probably damaging	1.00
R5287:Phkg2	UTSW	7	127,181,929 (GRCm39)	frame shift	probably null
R5416:Phkg2	UTSW	7	127,182,107 (GRCm39)	missense	possibly damaging	0.46
R7276:Phkg2	UTSW	7	127,181,558 (GRCm39)	missense	possibly damaging	0.80
R7655:Phkg2	UTSW	7	127,182,074 (GRCm39)	missense	probably damaging	0.99
R7656:Phkg2	UTSW	7	127,182,074 (GRCm39)	missense	probably damaging	0.99
R8504:Phkg2	UTSW	7	127,181,528 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CTCGATGTGGTGGTGCACA -3'
(R):5'- GCAATTCTAGGGTGTGGGTCA -3'

Sequencing Primer
(F):5'- CACCCAGTCTTACAGGATGTGATG -3'
(R):5'- GTGGGTCATGAATAGGGCC -3'

Posted On

2015-10-08