Incidental Mutation 'R4616:Psmd3'
ID351055
Institutional Source Beutler Lab
Gene Symbol Psmd3
Ensembl Gene ENSMUSG00000017221
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 3
SynonymsPsd3, AntP91a, Tstap91a
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4616 (G1)
Quality Score192
Status Validated
Chromosome11
Chromosomal Location98682554-98695979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98682926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000017365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017365]
Predicted Effect probably benign
Transcript: ENSMUST00000017365
AA Change: V66A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000017365
Gene: ENSMUSG00000017221
AA Change: V66A

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
PAM 217 389 1.07e-68 SMART
PINT 389 479 3.26e-27 SMART
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122854
Predicted Effect probably benign
Transcript: ENSMUST00000123676
SMART Domains Protein: ENSMUSP00000116968
Gene: ENSMUSG00000017221

DomainStartEndE-ValueType
PAM 2 198 2.1e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152102
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Psmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Psmd3 APN 11 98685568 missense probably benign 0.06
IGL01353:Psmd3 APN 11 98690600 missense probably benign 0.05
R1368:Psmd3 UTSW 11 98682920 missense probably damaging 1.00
R1563:Psmd3 UTSW 11 98694225 missense probably damaging 1.00
R2258:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R2259:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R3606:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R3607:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R4833:Psmd3 UTSW 11 98687760 missense probably damaging 1.00
R5033:Psmd3 UTSW 11 98682824 missense probably damaging 1.00
R5585:Psmd3 UTSW 11 98682881 missense possibly damaging 0.45
R5687:Psmd3 UTSW 11 98693669 missense probably damaging 1.00
R5929:Psmd3 UTSW 11 98695596 missense probably damaging 1.00
R6028:Psmd3 UTSW 11 98685665 missense probably damaging 0.99
R6240:Psmd3 UTSW 11 98693653 missense probably damaging 0.98
R6449:Psmd3 UTSW 11 98685640 missense probably benign
R6956:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7009:Psmd3 UTSW 11 98682766 missense probably benign 0.04
R7051:Psmd3 UTSW 11 98682833 missense possibly damaging 0.68
R7401:Psmd3 UTSW 11 98685640 missense probably benign
R7449:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7549:Psmd3 UTSW 11 98690961 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTGCAGCTGCTCGGTCATC -3'
(R):5'- AGAACAGGTTCGGTCATCGG -3'

Sequencing Primer
(F):5'- CCATGAAGCAGGAGGGCTC -3'
(R):5'- GTCATCGGCTGGGGTCG -3'
Posted On2015-10-08