Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:2010111I01Rik'

351061

Institutional Source

Beutler Lab

Gene Symbol

2010111I01Rik

Ensembl Gene

ENSMUSG00000021458

Gene Name

RIKEN cDNA 2010111I01 gene

Synonyms

ApO, aminopeptidase O

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62964893-63326096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63298751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 123 (E123K)

Ref Sequence

ENSEMBL: ENSMUSP00000152100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000220485] [ENSMUST00000220684] [ENSMUST00000220884]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021911
AA Change: E790K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: E790K

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	221	359	5.4e-11	PFAM
Pfam:Peptidase_M1	385	558	2.3e-15	PFAM
Pfam:Peptidase_MA_2	453	613	1.3e-12	PFAM
Leuk-A4-hydro_C	675	821	3.02e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083541

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083665

Predicted Effect

probably damaging
Transcript: ENSMUST00000091560
AA Change: E791K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: E791K

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	220	359	2.7e-11	PFAM
Pfam:Peptidase_M1	386	561	1.9e-15	PFAM
Leuk-A4-hydro_C	676	822	3.02e-37	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159152
AA Change: E134K

SMART Domains

Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458
AA Change: E134K

Domain	Start	End	E-Value	Type
Leuk-A4-hydro_C	1	113	4.63e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198479

Predicted Effect

probably benign
Transcript: ENSMUST00000220485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220670

Predicted Effect

probably benign
Transcript: ENSMUST00000220684

Predicted Effect

unknown
Transcript: ENSMUST00000220863
AA Change: E682K

Predicted Effect

unknown
Transcript: ENSMUST00000222929
AA Change: E149K

Predicted Effect

unknown
Transcript: ENSMUST00000221820
AA Change: E88K

Predicted Effect

probably damaging
Transcript: ENSMUST00000220884
AA Change: E123K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000222282
AA Change: E137K

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221164

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221501

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222721

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223073

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223204

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220885

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222846

Meta Mutation Damage Score

0.4033

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in 2010111I01Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:2010111I01Rik	APN	13	63199500	splice site	probably benign
IGL00329:2010111I01Rik	APN	13	63191163	missense	probably damaging	1.00
IGL00336:2010111I01Rik	APN	13	63015423	missense	possibly damaging	0.78
IGL01384:2010111I01Rik	APN	13	63190476	splice site	probably benign
IGL01780:2010111I01Rik	APN	13	63210125	missense	probably benign	0.00
IGL01876:2010111I01Rik	APN	13	63190522	missense	probably damaging	1.00
IGL02096:2010111I01Rik	APN	13	63061089	missense	probably benign	0.04
IGL02166:2010111I01Rik	APN	13	63015453	missense	probably benign	0.02
IGL02184:2010111I01Rik	APN	13	63068111	missense	possibly damaging	0.50
PIT4378001:2010111I01Rik	UTSW	13	63015207	missense	probably damaging	1.00
R0139:2010111I01Rik	UTSW	13	63190484	missense	probably benign	0.01
R1209:2010111I01Rik	UTSW	13	63191064	splice site	probably null
R1233:2010111I01Rik	UTSW	13	63199520	missense	probably damaging	0.96
R1756:2010111I01Rik	UTSW	13	63068061	missense	possibly damaging	0.95
R1786:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R1861:2010111I01Rik	UTSW	13	63015783	missense	probably damaging	1.00
R2130:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R2131:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R3076:2010111I01Rik	UTSW	13	63240115	missense	probably damaging	0.96
R3702:2010111I01Rik	UTSW	13	63015330	missense	probably benign	0.01
R3912:2010111I01Rik	UTSW	13	63156706	nonsense	probably null
R4512:2010111I01Rik	UTSW	13	63156667	missense	probably damaging	0.99
R4593:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4596:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4597:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4625:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4627:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4630:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4632:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4911:2010111I01Rik	UTSW	13	63170939	critical splice acceptor site	probably null
R5204:2010111I01Rik	UTSW	13	63033090	missense	probably benign	0.15
R5210:2010111I01Rik	UTSW	13	63068110	missense	probably benign	0.00
R5849:2010111I01Rik	UTSW	13	63015498	missense	probably benign	0.00
R5861:2010111I01Rik	UTSW	13	63298812	missense	probably damaging	1.00
R5960:2010111I01Rik	UTSW	13	63240273	missense	probably damaging	0.99
R6021:2010111I01Rik	UTSW	13	63061082	missense	probably damaging	1.00
R6048:2010111I01Rik	UTSW	13	63240325	missense	probably damaging	0.99
R6379:2010111I01Rik	UTSW	13	63068243	missense	probably damaging	0.97
R7038:2010111I01Rik	UTSW	13	63190525	missense	possibly damaging	0.54
R7493:2010111I01Rik	UTSW	13	63015531	missense	probably benign	0.01
R7788:2010111I01Rik	UTSW	13	63156593	missense	possibly damaging	0.89
R7970:2010111I01Rik	UTSW	13	63033160	missense	probably benign	0.11
R7988:2010111I01Rik	UTSW	13	63061140	missense	probably benign	0.00
R8041:2010111I01Rik	UTSW	13	63033107	missense	probably damaging	1.00
R8052:2010111I01Rik	UTSW	13	63068251	missense	probably damaging	1.00
R8053:2010111I01Rik	UTSW	13	63190531	nonsense	probably null
R8537:2010111I01Rik	UTSW	13	63190550	missense	probably damaging	1.00
R8554:2010111I01Rik	UTSW	13	63296897	missense	possibly damaging	0.94
R8681:2010111I01Rik	UTSW	13	63190559	missense	probably damaging	1.00
R8909:2010111I01Rik	UTSW	13	63240297	missense	possibly damaging	0.95
R8945:2010111I01Rik	UTSW	13	63240331	missense	probably null	1.00
R8990:2010111I01Rik	UTSW	13	63156614	missense	probably damaging	1.00
R9032:2010111I01Rik	UTSW	13	63296867	nonsense	probably null
R9049:2010111I01Rik	UTSW	13	63061038	missense	probably benign	0.00
R9166:2010111I01Rik	UTSW	13	63171048	critical splice donor site	probably null
R9590:2010111I01Rik	UTSW	13	63061109	missense	probably benign
Z1177:2010111I01Rik	UTSW	13	63170990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAGCTTCAGTTGGTCAC -3'
(R):5'- GAGATCCTGAGCCTTCTTCC -3'

Sequencing Primer
(F):5'- TCAGTTGGTCACCTGCACG -3'
(R):5'- AAGACCGTTTGGCAGCC -3'

Posted On

2015-10-08