Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Clec16a'

351066

Institutional Source

Beutler Lab

Gene Symbol

Clec16a

Ensembl Gene

ENSMUSG00000068663

Gene Name

C-type lectin domain family 16, member A

Synonyms

4932416N17Rik, curt

MMRRC Submission

041827-MU

Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10545339-10744878 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 10644883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]

AlphaFold

Q80U30

Predicted Effect

probably null
Transcript: ENSMUST00000038145

SMART Domains

Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	9.2e-61	PFAM
low complexity region	395	408	N/A	INTRINSIC
low complexity region	897	912	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000066345

SMART Domains

Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	1.1e-60	PFAM
coiled coil region	398	419	N/A	INTRINSIC
low complexity region	877	924	N/A	INTRINSIC
low complexity region	943	955	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115823

SMART Domains

Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
low complexity region	456	491	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115824

SMART Domains

Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	198	5.9e-66	PFAM
coiled coil region	398	419	N/A	INTRINSIC
low complexity region	877	924	N/A	INTRINSIC
low complexity region	943	955	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115827

SMART Domains

Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	8.7e-61	PFAM
low complexity region	395	408	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115828

SMART Domains

Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	2.1e-61	PFAM
low complexity region	395	408	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145866

Predicted Effect

probably null
Transcript: ENSMUST00000155633

SMART Domains

Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	1.1e-60	PFAM
coiled coil region	396	417	N/A	INTRINSIC
low complexity region	875	922	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC

Meta Mutation Damage Score

0.9502

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Clec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Clec16a	APN	16	10595896	missense	probably damaging	1.00
IGL00503:Clec16a	APN	16	10694649	missense	possibly damaging	0.53
IGL01622:Clec16a	APN	16	10577910	missense	possibly damaging	0.47
IGL01623:Clec16a	APN	16	10577910	missense	possibly damaging	0.47
IGL02008:Clec16a	APN	16	10580960	missense	probably damaging	1.00
IGL02082:Clec16a	APN	16	10614568	missense	probably damaging	1.00
IGL02468:Clec16a	APN	16	10741878	missense	probably benign	0.13
IGL02499:Clec16a	APN	16	10694676	missense	probably benign	0.25
IGL02671:Clec16a	APN	16	10627381	missense	probably benign	0.19
G5030:Clec16a	UTSW	16	10571561	missense	probably damaging	1.00
IGL03055:Clec16a	UTSW	16	10741781	missense	probably damaging	0.99
P0014:Clec16a	UTSW	16	10560156	splice site	probably benign
R0183:Clec16a	UTSW	16	10560022	missense	probably damaging	1.00
R0268:Clec16a	UTSW	16	10644828	nonsense	probably null
R0512:Clec16a	UTSW	16	10614580	missense	probably damaging	1.00
R0556:Clec16a	UTSW	16	10638785	critical splice acceptor site	probably null
R0944:Clec16a	UTSW	16	10688646	splice site	probably benign
R1456:Clec16a	UTSW	16	10691555	missense	probably damaging	1.00
R1497:Clec16a	UTSW	16	10635259	missense	probably damaging	1.00
R1580:Clec16a	UTSW	16	10595898	missense	probably damaging	1.00
R1933:Clec16a	UTSW	16	10688539	missense	probably damaging	0.99
R2075:Clec16a	UTSW	16	10741616	missense	probably benign	0.09
R2269:Clec16a	UTSW	16	10644786	missense	probably damaging	1.00
R2504:Clec16a	UTSW	16	10559687	intron	probably benign
R3011:Clec16a	UTSW	16	10611111	missense	probably benign	0.01
R4331:Clec16a	UTSW	16	10571669	missense	probably benign
R4775:Clec16a	UTSW	16	10638914	missense	probably damaging	1.00
R4969:Clec16a	UTSW	16	10568511	missense	probably damaging	1.00
R5053:Clec16a	UTSW	16	10576597	missense	probably damaging	1.00
R5170:Clec16a	UTSW	16	10741791	missense	probably benign
R5329:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5331:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5332:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5417:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5419:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5420:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5457:Clec16a	UTSW	16	10545532	splice site	probably null
R5623:Clec16a	UTSW	16	10611121	missense	probably benign	0.07
R6057:Clec16a	UTSW	16	10630087	missense	probably damaging	1.00
R6184:Clec16a	UTSW	16	10572928	splice site	probably null
R6235:Clec16a	UTSW	16	10694635	missense	probably damaging	1.00
R6260:Clec16a	UTSW	16	10694848	intron	probably benign
R6292:Clec16a	UTSW	16	10560151	critical splice donor site	probably null
R6318:Clec16a	UTSW	16	10630788	missense	probably damaging	1.00
R6894:Clec16a	UTSW	16	10644854	missense	probably damaging	1.00
R7340:Clec16a	UTSW	16	10580963	missense	probably null	0.21
R7432:Clec16a	UTSW	16	10688555	missense	possibly damaging	0.62
R7453:Clec16a	UTSW	16	10644822	missense	probably damaging	1.00
R7536:Clec16a	UTSW	16	10638844	missense	possibly damaging	0.90
R8207:Clec16a	UTSW	16	10627448	missense	probably benign	0.00
R8207:Clec16a	UTSW	16	10694710	missense	probably damaging	1.00
R8423:Clec16a	UTSW	16	10576663	missense	probably benign	0.04
R8447:Clec16a	UTSW	16	10741623	missense	probably benign	0.09
R8700:Clec16a	UTSW	16	10688558	missense	probably damaging	1.00
R8855:Clec16a	UTSW	16	10644867	missense	probably damaging	1.00
R9143:Clec16a	UTSW	16	10611100	missense	probably damaging	0.96
R9676:Clec16a	UTSW	16	10741959	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CACCATGCAATGCCTTCATGC -3'
(R):5'- AAAGGCCAGTGCTGTTCTC -3'

Sequencing Primer
(F):5'- AATGCCTTCATGCAGGGC -3'
(R):5'- GCCAGTGCTGTTCTCATGTCAG -3'

Posted On

2015-10-08