Incidental Mutation 'R4616:Slc35a5'
ID 351067
Institutional Source Beutler Lab
Gene Symbol Slc35a5
Ensembl Gene ENSMUSG00000022664
Gene Name solute carrier family 35, member A5
Synonyms 1010001J06Rik, D730043G07Rik, D16Ertd450e
MMRRC Submission 041827-MU
Accession Numbers

Genbank: NM_028756; MGI: 1921352

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45139573-45158706 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45144292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 193 (F193I)
Ref Sequence ENSEMBL: ENSMUSP00000137821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177]
AlphaFold Q921R7
Predicted Effect probably benign
Transcript: ENSMUST00000023344
AA Change: F193I

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664
AA Change: F193I

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114600
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152364
Predicted Effect probably benign
Transcript: ENSMUST00000180636
AA Change: F193I

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664
AA Change: F193I

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which belongs to subfamily 35A of the solute carrier superfamily. The encoded protein is a nucleoside-sugar transporter. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI

 All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Slc35a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc35a5 APN 16 45152608 nonsense probably null
IGL01012:Slc35a5 APN 16 45143832 missense probably damaging 1.00
IGL01396:Slc35a5 APN 16 45151503 missense probably damaging 1.00
IGL03293:Slc35a5 APN 16 45143781 missense probably damaging 1.00
3-1:Slc35a5 UTSW 16 45143892 missense probably damaging 0.99
R1532:Slc35a5 UTSW 16 45151557 missense probably benign 0.03
R1561:Slc35a5 UTSW 16 45151521 missense possibly damaging 0.93
R1864:Slc35a5 UTSW 16 45143708 missense possibly damaging 0.66
R2086:Slc35a5 UTSW 16 45144265 missense probably damaging 0.99
R2887:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2888:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2889:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2890:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R3080:Slc35a5 UTSW 16 45144395 missense probably benign 0.06
R3434:Slc35a5 UTSW 16 45144033 missense probably benign 0.23
R3720:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3722:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3916:Slc35a5 UTSW 16 45158158 intron probably benign
R3917:Slc35a5 UTSW 16 45158158 intron probably benign
R6648:Slc35a5 UTSW 16 45143917 missense probably damaging 1.00
R6881:Slc35a5 UTSW 16 45144080 missense possibly damaging 0.83
R7730:Slc35a5 UTSW 16 45143883 missense probably damaging 0.97
R7832:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R8113:Slc35a5 UTSW 16 45142188 missense unknown
R8726:Slc35a5 UTSW 16 45143658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATCAGAACGTGGCCCAAG -3'
(R):5'- TAGGGAATACTAGCAACTGTGTAC -3'

Sequencing Primer
(F):5'- AGCCCAAACGGATGTGAC -3'
(R):5'- TTTCAGTAGGACATTTAACAGGGG -3'
Posted On 2015-10-08