Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Adgrf5'

351069

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43452440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1078 (F1078L)

Ref Sequence

ENSEMBL: ENSMUSP00000153373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]

AlphaFold

G5E8Q8

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082648

Predicted Effect

probably benign
Transcript: ENSMUST00000113599
AA Change: F1283L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: F1283L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225962
AA Change: F1078L

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000226087
AA Change: F1283L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1888

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
goop	UTSW	17	43441969	missense	probably damaging	0.99
Heaped	UTSW	17	43447036	missense	possibly damaging	0.93
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
noel	UTSW	17	43430612	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R4645:Adgrf5	UTSW	17	43437525	missense	probably damaging	1.00
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R5856:Adgrf5	UTSW	17	43446120	missense	probably benign	0.09
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6602:Adgrf5	UTSW	17	43450304	missense	probably benign	0.32
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7717:Adgrf5	UTSW	17	43450753	missense	probably damaging	1.00
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7950:Adgrf5	UTSW	17	43451157	missense	probably damaging	0.99
R7988:Adgrf5	UTSW	17	43439813	intron	probably benign
R8188:Adgrf5	UTSW	17	43430612	missense	probably damaging	1.00
R8219:Adgrf5	UTSW	17	43449859	missense	probably benign	0.13
R8284:Adgrf5	UTSW	17	43455270	missense	unknown
R8460:Adgrf5	UTSW	17	43439808	intron	probably benign
R8504:Adgrf5	UTSW	17	43446949	missense	probably benign	0.01
R8751:Adgrf5	UTSW	17	43437683	missense	possibly damaging	0.80
R8852:Adgrf5	UTSW	17	43453098	missense	possibly damaging	0.82
R9196:Adgrf5	UTSW	17	43445104	missense	possibly damaging	0.94
R9418:Adgrf5	UTSW	17	43426973	missense	probably benign	0.00
R9671:Adgrf5	UTSW	17	43449904	missense	probably damaging	1.00
R9734:Adgrf5	UTSW	17	43452308	missense	probably damaging	1.00
R9756:Adgrf5	UTSW	17	43450246	missense	probably benign	0.01
R9765:Adgrf5	UTSW	17	43437600	missense	probably damaging	1.00
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00
Z1191:Adgrf5	UTSW	17	43445035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GCTCTTGATCCTTTCTGCAGGG -3'
(R):5'- CAGGGTATGGAATGCTCTGG -3'

Sequencing Primer
(F):5'- GCAGGGGCTCTTCATTTTGCTC -3'
(R):5'- AATGCTCTGGGCTGGAGAC -3'

Posted On

2015-10-08