Incidental Mutation 'R4616:Adgrf5'
ID 351069
Institutional Source Beutler Lab
Gene Symbol Adgrf5
Ensembl Gene ENSMUSG00000056492
Gene Name adhesion G protein-coupled receptor F5
Synonyms Gpr116, 8430401C09Rik
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 43360451-43459557 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43452440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1078 (F1078L)
Ref Sequence ENSEMBL: ENSMUSP00000153373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]
AlphaFold G5E8Q8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082648
Predicted Effect probably benign
Transcript: ENSMUST00000113599
AA Change: F1283L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: F1283L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225962
AA Change: F1078L

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226087
AA Change: F1283L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1888 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Adgrf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
goop UTSW 17 43441969 missense probably damaging 0.99
Heaped UTSW 17 43447036 missense possibly damaging 0.93
la_brea UTSW 17 43452323 critical splice donor site probably null
Motel UTSW 17 43450380 missense probably damaging 1.00
noel UTSW 17 43430612 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
sweetie UTSW 17 43450983 missense probably damaging 0.96
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1523:Adgrf5 UTSW 17 43450153 missense probably benign 0.00
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1767:Adgrf5 UTSW 17 43450564 missense possibly damaging 0.87
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5326:Adgrf5 UTSW 17 43440074 missense probably damaging 0.98
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6007:Adgrf5 UTSW 17 43437571 missense probably damaging 0.98
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
R7331:Adgrf5 UTSW 17 43437593 missense probably damaging 0.99
R7346:Adgrf5 UTSW 17 43451179 missense probably damaging 1.00
R7350:Adgrf5 UTSW 17 43428444 critical splice acceptor site probably null
R7667:Adgrf5 UTSW 17 43446039 missense probably benign 0.01
R7717:Adgrf5 UTSW 17 43450753 missense probably damaging 1.00
R7731:Adgrf5 UTSW 17 43450560 missense probably damaging 1.00
R7877:Adgrf5 UTSW 17 43441838 missense possibly damaging 0.63
R7950:Adgrf5 UTSW 17 43451157 missense probably damaging 0.99
R7988:Adgrf5 UTSW 17 43439813 intron probably benign
R8188:Adgrf5 UTSW 17 43430612 missense probably damaging 1.00
R8219:Adgrf5 UTSW 17 43449859 missense probably benign 0.13
R8284:Adgrf5 UTSW 17 43455270 missense unknown
R8460:Adgrf5 UTSW 17 43439808 intron probably benign
R8504:Adgrf5 UTSW 17 43446949 missense probably benign 0.01
R8751:Adgrf5 UTSW 17 43437683 missense possibly damaging 0.80
R8852:Adgrf5 UTSW 17 43453098 missense possibly damaging 0.82
R9196:Adgrf5 UTSW 17 43445104 missense possibly damaging 0.94
R9418:Adgrf5 UTSW 17 43426973 missense probably benign 0.00
R9671:Adgrf5 UTSW 17 43449904 missense probably damaging 1.00
R9734:Adgrf5 UTSW 17 43452308 missense probably damaging 1.00
R9756:Adgrf5 UTSW 17 43450246 missense probably benign 0.01
R9765:Adgrf5 UTSW 17 43437600 missense probably damaging 1.00
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Z1177:Adgrf5 UTSW 17 43445053 missense probably benign 0.00
Z1191:Adgrf5 UTSW 17 43445035 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCTCTTGATCCTTTCTGCAGGG -3'
(R):5'- CAGGGTATGGAATGCTCTGG -3'

Sequencing Primer
(F):5'- GCAGGGGCTCTTCATTTTGCTC -3'
(R):5'- AATGCTCTGGGCTGGAGAC -3'
Posted On 2015-10-08