Mutagenetix > Incidental Mutations

Incidental Mutation 'R4616:Dsg3'

351072

Institutional Source

Beutler Lab

Gene Symbol

Dsg3

Ensembl Gene

ENSMUSG00000056632

Gene Name

desmoglein 3

Synonyms

MMRRC Submission

041827-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.470) question?

Stock #

R4616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20510304-20541310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20531559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 538 (V538A)

Ref Sequence

ENSEMBL: ENSMUSP00000064718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070892]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070892
AA Change: V538A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: V538A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.9e-13	SMART
CA	179	265	2.36e-21	SMART
CA	288	382	1.55e-7	SMART
CA	409	493	6.15e-11	SMART
low complexity region	615	638	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	725	736	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,610	E149G	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Dsg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Dsg3	APN	18	20539654	missense	probably damaging	1.00
IGL00697:Dsg3	APN	18	20524689	critical splice donor site	probably null
IGL00966:Dsg3	APN	18	20523607	missense	probably benign	0.02
IGL01352:Dsg3	APN	18	20523696	missense	probably benign	0.25
IGL01953:Dsg3	APN	18	20525304	missense	probably damaging	1.00
IGL02385:Dsg3	APN	18	20527714	missense	probably damaging	1.00
IGL02622:Dsg3	APN	18	20528947	splice site	probably benign
IGL02643:Dsg3	APN	18	20528955	missense	probably benign	0.00
IGL02740:Dsg3	APN	18	20527708	missense	possibly damaging	0.93
IGL03012:Dsg3	APN	18	20537243	critical splice acceptor site	probably null
IGL03026:Dsg3	APN	18	20536972	splice site	probably null
IGL03063:Dsg3	APN	18	20533368	splice site	probably benign
IGL03098:Dsg3	APN	18	20510365	utr 5 prime	probably benign
IGL03132:Dsg3	APN	18	20524596	missense	probably damaging	1.00
IGL03352:Dsg3	APN	18	20527632	missense	probably benign
P0035:Dsg3	UTSW	18	20539969	missense	probably benign	0.05
R0039:Dsg3	UTSW	18	20521484	missense	probably benign	0.36
R0099:Dsg3	UTSW	18	20540022	missense	probably benign	0.01
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0143:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R0194:Dsg3	UTSW	18	20540142	missense	probably damaging	1.00
R0373:Dsg3	UTSW	18	20539747	missense	probably damaging	1.00
R0517:Dsg3	UTSW	18	20529025	missense	probably benign	0.06
R0521:Dsg3	UTSW	18	20527815	missense	possibly damaging	0.53
R1194:Dsg3	UTSW	18	20525220	missense	probably damaging	0.98
R1551:Dsg3	UTSW	18	20536918	missense	possibly damaging	0.84
R1762:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R1957:Dsg3	UTSW	18	20522105	missense	probably damaging	1.00
R2061:Dsg3	UTSW	18	20527737	nonsense	probably null
R2071:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R2513:Dsg3	UTSW	18	20523662	missense	possibly damaging	0.48
R2571:Dsg3	UTSW	18	20540005	missense	probably benign	0.01
R2945:Dsg3	UTSW	18	20539935	missense	probably benign
R2968:Dsg3	UTSW	18	20525225	missense	possibly damaging	0.75
R3906:Dsg3	UTSW	18	20538499	missense	probably damaging	1.00
R4641:Dsg3	UTSW	18	20520558	missense	probably benign	0.28
R4685:Dsg3	UTSW	18	20539736	missense	probably benign	0.08
R5690:Dsg3	UTSW	18	20522051	missense	probably benign	0.01
R5786:Dsg3	UTSW	18	20521571	missense	possibly damaging	0.46
R5950:Dsg3	UTSW	18	20538529	missense	probably damaging	1.00
R6131:Dsg3	UTSW	18	20538512	missense	probably damaging	0.99
R6131:Dsg3	UTSW	18	20520477	splice site	probably null
R6243:Dsg3	UTSW	18	20539724	missense	probably damaging	1.00
R6315:Dsg3	UTSW	18	20524586	missense	probably benign	0.08
R6327:Dsg3	UTSW	18	20539870	missense	probably benign
R6418:Dsg3	UTSW	18	20523760	critical splice donor site	probably null
R6464:Dsg3	UTSW	18	20533526	missense	probably benign	0.00
R6497:Dsg3	UTSW	18	20537248	missense	probably benign	0.33
R6518:Dsg3	UTSW	18	20533422	missense	probably benign	0.23
R6551:Dsg3	UTSW	18	20539911	missense	unknown
R6685:Dsg3	UTSW	18	20520615	critical splice donor site	probably null
R6952:Dsg3	UTSW	18	20525159	missense	possibly damaging	0.77
R7357:Dsg3	UTSW	18	20539783	missense	probably damaging	1.00
R7385:Dsg3	UTSW	18	20540197	missense	possibly damaging	0.52
R7456:Dsg3	UTSW	18	20531363	missense	probably benign	0.17
R7506:Dsg3	UTSW	18	20533464	missense	probably benign	0.31
R7570:Dsg3	UTSW	18	20527780	missense	possibly damaging	0.95
R7980:Dsg3	UTSW	18	20531360	missense	probably benign	0.00
R8100:Dsg3	UTSW	18	20528971	missense	probably benign	0.08
R8147:Dsg3	UTSW	18	20540073	missense	probably benign
R8242:Dsg3	UTSW	18	20536923	missense	possibly damaging	0.93
R8415:Dsg3	UTSW	18	20523708	missense	probably damaging	1.00
R8494:Dsg3	UTSW	18	20540214	missense	probably benign	0.03
R8930:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8932:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8998:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R8999:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R9336:Dsg3	UTSW	18	20524685	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- ACAATATATGTGGAAGTGCCCAG -3'
(R):5'- CCTCAGCTCGACAGTGATAC -3'

Sequencing Primer
(F):5'- ATATGTGGAAGTGCCCAGTTTTAATG -3'
(R):5'- CCCATAAGACAGCAAATAGTGTTAG -3'

Posted On

2015-10-08