Incidental Mutation 'R4616:Dsg3'
ID 351072
Institutional Source Beutler Lab
Gene Symbol Dsg3
Ensembl Gene ENSMUSG00000056632
Gene Name desmoglein 3
Synonyms
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.539) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20510304-20541310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20531559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 538 (V538A)
Ref Sequence ENSEMBL: ENSMUSP00000064718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070892]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070892
AA Change: V538A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: V538A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.9e-13 SMART
CA 179 265 2.36e-21 SMART
CA 288 382 1.55e-7 SMART
CA 409 493 6.15e-11 SMART
low complexity region 615 638 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Dsg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Dsg3 APN 18 20539654 missense probably damaging 1.00
IGL00697:Dsg3 APN 18 20524689 critical splice donor site probably null
IGL00966:Dsg3 APN 18 20523607 missense probably benign 0.02
IGL01352:Dsg3 APN 18 20523696 missense probably benign 0.25
IGL01953:Dsg3 APN 18 20525304 missense probably damaging 1.00
IGL02385:Dsg3 APN 18 20527714 missense probably damaging 1.00
IGL02622:Dsg3 APN 18 20528947 splice site probably benign
IGL02643:Dsg3 APN 18 20528955 missense probably benign 0.00
IGL02740:Dsg3 APN 18 20527708 missense possibly damaging 0.93
IGL03012:Dsg3 APN 18 20537243 critical splice acceptor site probably null
IGL03026:Dsg3 APN 18 20536972 splice site probably null
IGL03063:Dsg3 APN 18 20533368 splice site probably benign
IGL03098:Dsg3 APN 18 20510365 utr 5 prime probably benign
IGL03132:Dsg3 APN 18 20524596 missense probably damaging 1.00
IGL03352:Dsg3 APN 18 20527632 missense probably benign
P0035:Dsg3 UTSW 18 20539969 missense probably benign 0.05
R0039:Dsg3 UTSW 18 20521484 missense probably benign 0.36
R0099:Dsg3 UTSW 18 20540022 missense probably benign 0.01
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0109:Dsg3 UTSW 18 20540134 missense probably damaging 0.96
R0143:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R0194:Dsg3 UTSW 18 20540142 missense probably damaging 1.00
R0373:Dsg3 UTSW 18 20539747 missense probably damaging 1.00
R0517:Dsg3 UTSW 18 20529025 missense probably benign 0.06
R0521:Dsg3 UTSW 18 20527815 missense possibly damaging 0.53
R1194:Dsg3 UTSW 18 20525220 missense probably damaging 0.98
R1551:Dsg3 UTSW 18 20536918 missense possibly damaging 0.84
R1762:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R1957:Dsg3 UTSW 18 20522105 missense probably damaging 1.00
R2061:Dsg3 UTSW 18 20527737 nonsense probably null
R2071:Dsg3 UTSW 18 20536825 missense probably damaging 1.00
R2513:Dsg3 UTSW 18 20523662 missense possibly damaging 0.48
R2571:Dsg3 UTSW 18 20540005 missense probably benign 0.01
R2945:Dsg3 UTSW 18 20539935 missense probably benign
R2968:Dsg3 UTSW 18 20525225 missense possibly damaging 0.75
R3906:Dsg3 UTSW 18 20538499 missense probably damaging 1.00
R4641:Dsg3 UTSW 18 20520558 missense probably benign 0.28
R4685:Dsg3 UTSW 18 20539736 missense probably benign 0.08
R5690:Dsg3 UTSW 18 20522051 missense probably benign 0.01
R5786:Dsg3 UTSW 18 20521571 missense possibly damaging 0.46
R5950:Dsg3 UTSW 18 20538529 missense probably damaging 1.00
R6131:Dsg3 UTSW 18 20538512 missense probably damaging 0.99
R6131:Dsg3 UTSW 18 20520477 splice site probably null
R6243:Dsg3 UTSW 18 20539724 missense probably damaging 1.00
R6315:Dsg3 UTSW 18 20524586 missense probably benign 0.08
R6327:Dsg3 UTSW 18 20539870 missense probably benign
R6418:Dsg3 UTSW 18 20523760 critical splice donor site probably null
R6464:Dsg3 UTSW 18 20533526 missense probably benign 0.00
R6497:Dsg3 UTSW 18 20537248 missense probably benign 0.33
R6518:Dsg3 UTSW 18 20533422 missense probably benign 0.23
R6551:Dsg3 UTSW 18 20539911 missense unknown
R6685:Dsg3 UTSW 18 20520615 critical splice donor site probably null
R6952:Dsg3 UTSW 18 20525159 missense possibly damaging 0.77
R7357:Dsg3 UTSW 18 20539783 missense probably damaging 1.00
R7385:Dsg3 UTSW 18 20540197 missense possibly damaging 0.52
R7456:Dsg3 UTSW 18 20531363 missense probably benign 0.17
R7506:Dsg3 UTSW 18 20533464 missense probably benign 0.31
R7570:Dsg3 UTSW 18 20527780 missense possibly damaging 0.95
R7980:Dsg3 UTSW 18 20531360 missense probably benign 0.00
R8100:Dsg3 UTSW 18 20528971 missense probably benign 0.08
R8147:Dsg3 UTSW 18 20540073 missense probably benign
R8242:Dsg3 UTSW 18 20536923 missense possibly damaging 0.93
R8415:Dsg3 UTSW 18 20523708 missense probably damaging 1.00
R8494:Dsg3 UTSW 18 20540214 missense probably benign 0.03
R8930:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8932:Dsg3 UTSW 18 20539661 missense probably damaging 1.00
R8998:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R8999:Dsg3 UTSW 18 20533627 missense probably damaging 1.00
R9336:Dsg3 UTSW 18 20524685 missense probably benign 0.19
R9498:Dsg3 UTSW 18 20525221 missense probably damaging 0.98
R9598:Dsg3 UTSW 18 20539732 missense probably damaging 1.00
R9601:Dsg3 UTSW 18 20533521 missense probably damaging 1.00
R9748:Dsg3 UTSW 18 20539704 missense possibly damaging 0.87
R9794:Dsg3 UTSW 18 20540097 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATATATGTGGAAGTGCCCAG -3'
(R):5'- CCTCAGCTCGACAGTGATAC -3'

Sequencing Primer
(F):5'- ATATGTGGAAGTGCCCAGTTTTAATG -3'
(R):5'- CCCATAAGACAGCAAATAGTGTTAG -3'
Posted On 2015-10-08