Incidental Mutation 'R4616:Rbm27'
ID 351074
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene Name RNA binding motif protein 27
Synonyms Psc1
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 42275353-42341542 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42301775 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 301 (D301E)
Ref Sequence ENSEMBL: ENSMUSP00000089540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
AlphaFold Q5SFM8
Predicted Effect probably damaging
Transcript: ENSMUST00000046972
AA Change: D301E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491
AA Change: D301E

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091920
AA Change: D301E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491
AA Change: D301E

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175194
Meta Mutation Damage Score 0.4814 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42319814 missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42301840 missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42319913 missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42333399 critical splice donor site probably null
IGL03085:Rbm27 APN 18 42327524 splice site probably benign
IGL03249:Rbm27 APN 18 42301747 missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42305716 missense probably damaging 0.99
messenger UTSW 18 42333403 splice site probably null
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0111:Rbm27 UTSW 18 42305672 splice site probably benign
R0122:Rbm27 UTSW 18 42313968 intron probably benign
R0707:Rbm27 UTSW 18 42326026 critical splice donor site probably null
R1253:Rbm27 UTSW 18 42301774 missense probably damaging 0.99
R1268:Rbm27 UTSW 18 42333302 missense probably damaging 1.00
R1317:Rbm27 UTSW 18 42324051 splice site probably benign
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42325957 missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42292112 splice site probably benign
R3123:Rbm27 UTSW 18 42327165 missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42292112 splice site probably benign
R3712:Rbm27 UTSW 18 42292112 splice site probably benign
R4839:Rbm27 UTSW 18 42327445 missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42338444 missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42327210 missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42317666 missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42300385 missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42327505 missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42333318 missense probably damaging 1.00
R6499:Rbm27 UTSW 18 42337011 missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42324113 missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42325939 missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42301864 missense probably benign 0.00
R6812:Rbm27 UTSW 18 42333403 splice site probably null
R7162:Rbm27 UTSW 18 42314027 missense unknown
R7606:Rbm27 UTSW 18 42327513 missense probably damaging 1.00
R7904:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
R7969:Rbm27 UTSW 18 42275480 start gained probably benign
R8177:Rbm27 UTSW 18 42324110 missense probably damaging 1.00
R9052:Rbm27 UTSW 18 42332828 missense probably damaging 1.00
R9091:Rbm27 UTSW 18 42305764 missense probably benign 0.06
R9206:Rbm27 UTSW 18 42314098 nonsense probably null
R9269:Rbm27 UTSW 18 42327507 missense probably benign 0.02
R9270:Rbm27 UTSW 18 42305764 missense probably benign 0.06
X0065:Rbm27 UTSW 18 42299320 missense possibly damaging 0.70
Z1176:Rbm27 UTSW 18 42333234 frame shift probably null
Z1177:Rbm27 UTSW 18 42338452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTCTACTTCAAGGCTATGTG -3'
(R):5'- CTTGAGGAACAGGAAGTCTCATAC -3'

Sequencing Primer
(F):5'- CAAGGCTATGTGGTCATTAATAGG -3'
(R):5'- TCATACTATGACCAGGGCCTG -3'
Posted On 2015-10-08