Incidental Mutation 'R4616:Pcsk5'
ID351075
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4616 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17560750 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 904 (Q904H)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably benign
Transcript: ENSMUST00000025618
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050715
AA Change: Q904H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: Q904H

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Meta Mutation Damage Score 0.1618 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R7986:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGTTCACCATCTCCCTG -3'
(R):5'- GTGGACCAAATTCCCTCCTG -3'

Sequencing Primer
(F):5'- TCCCTGCACAAACTTGAGATAGAGAG -3'
(R):5'- TGGGCCTGCTCCTGAATGAC -3'
Posted On2015-10-08