Mutagenetix > Incidental Mutation

Incidental Mutation 'R4616:Ifit1bl1'

351076

Institutional Source

Beutler Lab

Gene Symbol

Ifit1bl1

Ensembl Gene

ENSMUSG00000079339

Gene Name

interferon induced protein with tetratricpeptide repeats 1B like 1

Synonyms

Gm14446

MMRRC Submission

041827-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4616 (G1)

Quality Score

135

Status

Validated

Chromosome

Chromosomal Location

34592888-34601968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34594610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 149 (E149G)

Ref Sequence

ENSEMBL: ENSMUSP00000132781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]

AlphaFold

D3Z6F0

Predicted Effect

probably damaging
Transcript: ENSMUST00000112467
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: E149G

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168254
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: E149G

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Meta Mutation Damage Score

0.8321

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	A	13: 63,298,751	E123K	probably damaging	Het
4931417E11Rik	A	G	6: 73,469,269	V99A	probably benign	Het
Acod1	C	T	14: 103,055,345	T435M	probably benign	Het
Adgrf5	T	C	17: 43,452,440	F1078L	probably benign	Het
Adh6a	A	T	3: 138,324,947	N110I	probably damaging	Het
Aldh16a1	T	C	7: 45,148,788		probably benign	Het
Arhgef17	A	G	7: 100,882,485	F1302S	probably damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bpifa6	T	C	2: 153,982,988	S28P	possibly damaging	Het
C9	A	G	15: 6,491,463	D51G	probably damaging	Het
Cfb	T	A	17: 34,859,068	H962L	probably benign	Het
Chn2	G	A	6: 54,290,403	M292I	probably damaging	Het
Clec16a	T	A	16: 10,644,883		probably null	Het
Cyp1a1	T	C	9: 57,701,756	S307P	probably benign	Het
Dsg3	T	C	18: 20,531,559	V538A	probably benign	Het
Erbb3	G	A	10: 128,572,770	Q815*	probably null	Het
Fam90a1a	C	A	8: 21,963,846	Q406K	possibly damaging	Het
Frmd3	T	C	4: 74,187,872	V585A	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gm8214	T	C	1: 183,681,897		noncoding transcript	Het
Gpld1	G	A	13: 24,984,816	G771D	probably damaging	Het
Gpr20	T	C	15: 73,695,736	N268S	probably benign	Het
Gria2	A	T	3: 80,706,897	I612N	probably damaging	Het
Ighv1-82	T	C	12: 115,952,660	T77A	probably benign	Het
Ighv2-9	G	T	12: 113,879,219	T76K	probably damaging	Het
Igkv6-13	A	T	6: 70,458,035	M1K	probably null	Het
Igkv8-21	A	T	6: 70,315,157	S34T	probably benign	Het
Itpr1	A	G	6: 108,481,223	N1985D	probably damaging	Het
Lama3	T	C	18: 12,504,397		probably null	Het
Lamc2	T	C	1: 153,166,169	Y73C	probably damaging	Het
Maff	A	G	15: 79,357,698	D105G	probably damaging	Het
Mep1a	C	T	17: 43,486,241	V312M	possibly damaging	Het
Mfap4	C	A	11: 61,485,509		probably benign	Het
Mrgbp	A	T	2: 180,585,314		silent	Het
Mtmr4	T	C	11: 87,610,935	L548S	probably damaging	Het
Myo7b	T	C	18: 32,003,487		probably null	Het
Myo9a	T	C	9: 59,821,649	I596T	probably damaging	Het
Olfr38	G	T	6: 42,762,418	R122L	probably benign	Het
Olfr594	C	T	7: 103,220,422	R235*	probably null	Het
Pcsk5	T	G	19: 17,560,750	Q904H	probably benign	Het
Pdzrn3	G	T	6: 101,152,009	H565Q	probably damaging	Het
Phkg2	C	T	7: 127,577,620	R61W	probably damaging	Het
Pkd2l1	C	A	19: 44,154,134	A490S	probably damaging	Het
Pomgnt1	T	A	4: 116,154,890	I337N	probably damaging	Het
Psmd3	T	C	11: 98,682,926	V66A	probably benign	Het
Ptger3	T	C	3: 157,567,294	S93P	probably damaging	Het
Rbm27	T	A	18: 42,301,775	D301E	probably damaging	Het
Rdh16	A	T	10: 127,801,513		probably null	Het
Slc35a5	A	T	16: 45,144,292	F193I	probably benign	Het
Slc4a4	A	G	5: 89,038,561	K167R	probably damaging	Het
Sort1	A	T	3: 108,355,541	T772S	possibly damaging	Het
Sptbn5	T	A	2: 120,048,757		noncoding transcript	Het
Stard5	G	T	7: 83,633,281		probably benign	Het
Tbc1d22a	A	G	15: 86,235,685	T61A	probably damaging	Het
Tox2	T	C	2: 163,320,647	L479P	probably damaging	Het
Usp53	A	T	3: 122,959,120	M80K	probably damaging	Het
Vmn1r209	A	T	13: 22,805,965	L185Q	probably damaging	Het
Vmn2r59	A	G	7: 42,012,438	I651T	probably benign	Het
Vsig1	G	T	X: 140,926,386	A95S	probably benign	Het
Zfhx4	T	C	3: 5,413,067	S3556P	possibly damaging	Het

Other mutations in Ifit1bl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4544001:Ifit1bl1	UTSW	19	34594015	missense	possibly damaging	0.79
R0420:Ifit1bl1	UTSW	19	34594514	missense	probably damaging	1.00
R1161:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1310:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1483:Ifit1bl1	UTSW	19	34594641	missense	possibly damaging	0.88
R1606:Ifit1bl1	UTSW	19	34594044	missense	probably benign	0.00
R1753:Ifit1bl1	UTSW	19	34593860	missense	probably benign	0.15
R1778:Ifit1bl1	UTSW	19	34594193	missense	probably damaging	1.00
R2204:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2205:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2442:Ifit1bl1	UTSW	19	34594889	missense	probably benign	0.00
R2858:Ifit1bl1	UTSW	19	34594322	missense	probably benign	0.01
R3422:Ifit1bl1	UTSW	19	34593950	missense	probably benign	0.04
R4081:Ifit1bl1	UTSW	19	34594640	missense	possibly damaging	0.63
R4125:Ifit1bl1	UTSW	19	34594788	missense	probably damaging	0.99
R4731:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4732:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4849:Ifit1bl1	UTSW	19	34594676	missense	probably damaging	1.00
R5026:Ifit1bl1	UTSW	19	34593893	missense	probably damaging	1.00
R5049:Ifit1bl1	UTSW	19	34594081	nonsense	probably null
R5414:Ifit1bl1	UTSW	19	34593924	missense	probably damaging	0.99
R5561:Ifit1bl1	UTSW	19	34593797	nonsense	probably null
R5586:Ifit1bl1	UTSW	19	34594277	missense	probably damaging	0.98
R6345:Ifit1bl1	UTSW	19	34594170	nonsense	probably null
R6382:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R6515:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R7073:Ifit1bl1	UTSW	19	34599267	critical splice donor site	probably null
R7180:Ifit1bl1	UTSW	19	34593902	missense	probably damaging	1.00
R7210:Ifit1bl1	UTSW	19	34594164	missense	probably benign	0.00
R7665:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R7724:Ifit1bl1	UTSW	19	34594005	missense	probably benign	0.00
R7783:Ifit1bl1	UTSW	19	34593936	missense	probably benign	0.01
R7944:Ifit1bl1	UTSW	19	34593824	missense	probably benign	0.00
R8251:Ifit1bl1	UTSW	19	34594832	missense	possibly damaging	0.85
R8427:Ifit1bl1	UTSW	19	34599266	critical splice donor site	probably null
R8474:Ifit1bl1	UTSW	19	34594862	missense	probably damaging	1.00
R8933:Ifit1bl1	UTSW	19	34594013	missense	probably damaging	0.99
R9095:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R9282:Ifit1bl1	UTSW	19	34594508	missense	probably benign	0.28
R9314:Ifit1bl1	UTSW	19	34599293	missense	probably benign	0.08
R9432:Ifit1bl1	UTSW	19	34594098	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GTTTTACGCTGACAGCCTTC -3'
(R):5'- AGCCCTGCAGAGCTTGAAAG -3'

Sequencing Primer
(F):5'- CAGCCTTCTGTAAATGTTGGAGC -3'
(R):5'- TGAAGCCTTGATCCAGAGC -3'

Posted On

2015-10-08