Incidental Mutation 'R4616:Ifit1bl1'
ID 351076
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Name interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms Gm14446
MMRRC Submission 041827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4616 (G1)
Quality Score 135
Status Validated
Chromosome 19
Chromosomal Location 34570291-34579356 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34572010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 149 (E149G)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
AlphaFold D3Z6F0
Predicted Effect probably damaging
Transcript: ENSMUST00000112467
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: E149G

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168254
AA Change: E149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: E149G

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Meta Mutation Damage Score 0.8321 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 C T 14: 103,292,781 (GRCm39) T435M probably benign Het
Adgrf5 T C 17: 43,763,331 (GRCm39) F1078L probably benign Het
Adh6a A T 3: 138,030,708 (GRCm39) N110I probably damaging Het
Aldh16a1 T C 7: 44,798,212 (GRCm39) probably benign Het
Aopep G A 13: 63,446,565 (GRCm39) E123K probably damaging Het
Arhgef17 A G 7: 100,531,692 (GRCm39) F1302S probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bpifa6 T C 2: 153,824,908 (GRCm39) S28P possibly damaging Het
C9 A G 15: 6,520,944 (GRCm39) D51G probably damaging Het
Cfb T A 17: 35,078,044 (GRCm39) H962L probably benign Het
Chn2 G A 6: 54,267,388 (GRCm39) M292I probably damaging Het
Clec16a T A 16: 10,462,747 (GRCm39) probably null Het
Cyp1a1 T C 9: 57,609,039 (GRCm39) S307P probably benign Het
Dsg3 T C 18: 20,664,616 (GRCm39) V538A probably benign Het
Erbb3 G A 10: 128,408,639 (GRCm39) Q815* probably null Het
Fam90a1a C A 8: 22,453,862 (GRCm39) Q406K possibly damaging Het
Frmd3 T C 4: 74,106,109 (GRCm39) V585A probably benign Het
Gm8214 T C 1: 183,414,094 (GRCm39) noncoding transcript Het
Gpld1 G A 13: 25,168,799 (GRCm39) G771D probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Gria2 A T 3: 80,614,204 (GRCm39) I612N probably damaging Het
Ighv1-82 T C 12: 115,916,280 (GRCm39) T77A probably benign Het
Ighv2-9 G T 12: 113,842,839 (GRCm39) T76K probably damaging Het
Igkv6-13 A T 6: 70,435,019 (GRCm39) M1K probably null Het
Igkv8-21 A T 6: 70,292,141 (GRCm39) S34T probably benign Het
Itpr1 A G 6: 108,458,184 (GRCm39) N1985D probably damaging Het
Jkampl A G 6: 73,446,252 (GRCm39) V99A probably benign Het
Lama3 T C 18: 12,637,454 (GRCm39) probably null Het
Lamc2 T C 1: 153,041,915 (GRCm39) Y73C probably damaging Het
Maff A G 15: 79,241,898 (GRCm39) D105G probably damaging Het
Mep1a C T 17: 43,797,132 (GRCm39) V312M possibly damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrgbp A T 2: 180,227,107 (GRCm39) silent Het
Mtmr4 T C 11: 87,501,761 (GRCm39) L548S probably damaging Het
Myo7b T C 18: 32,136,540 (GRCm39) probably null Het
Myo9a T C 9: 59,728,932 (GRCm39) I596T probably damaging Het
Or2f1b G T 6: 42,739,352 (GRCm39) R122L probably benign Het
Or52e3 C T 7: 102,869,629 (GRCm39) R235* probably null Het
Pcsk5 T G 19: 17,538,114 (GRCm39) Q904H probably benign Het
Pdzrn3 G T 6: 101,128,970 (GRCm39) H565Q probably damaging Het
Phkg2 C T 7: 127,176,792 (GRCm39) R61W probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Pomgnt1 T A 4: 116,012,087 (GRCm39) I337N probably damaging Het
Psmd3 T C 11: 98,573,752 (GRCm39) V66A probably benign Het
Ptger3 T C 3: 157,272,931 (GRCm39) S93P probably damaging Het
Rbm27 T A 18: 42,434,840 (GRCm39) D301E probably damaging Het
Rdh16 A T 10: 127,637,382 (GRCm39) probably null Het
Slc35a5 A T 16: 44,964,655 (GRCm39) F193I probably benign Het
Slc4a4 A G 5: 89,186,420 (GRCm39) K167R probably damaging Het
Sort1 A T 3: 108,262,857 (GRCm39) T772S possibly damaging Het
Sptbn5 T A 2: 119,879,238 (GRCm39) noncoding transcript Het
Stard5 G T 7: 83,282,489 (GRCm39) probably benign Het
Tbc1d22a A G 15: 86,119,886 (GRCm39) T61A probably damaging Het
Tox2 T C 2: 163,162,567 (GRCm39) L479P probably damaging Het
Usp53 A T 3: 122,752,769 (GRCm39) M80K probably damaging Het
Vmn1r209 A T 13: 22,990,135 (GRCm39) L185Q probably damaging Het
Vmn2r59 A G 7: 41,661,862 (GRCm39) I651T probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Zfhx4 T C 3: 5,478,127 (GRCm39) S3556P possibly damaging Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34,571,415 (GRCm39) missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34,571,914 (GRCm39) missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34,571,096 (GRCm39) missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34,571,096 (GRCm39) missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34,572,041 (GRCm39) missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34,571,444 (GRCm39) missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34,571,260 (GRCm39) missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34,571,593 (GRCm39) missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34,571,741 (GRCm39) missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34,571,741 (GRCm39) missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34,572,289 (GRCm39) missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34,571,722 (GRCm39) missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34,571,350 (GRCm39) missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34,572,040 (GRCm39) missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34,572,188 (GRCm39) missense probably damaging 0.99
R4731:Ifit1bl1 UTSW 19 34,571,721 (GRCm39) missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34,571,721 (GRCm39) missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34,572,076 (GRCm39) missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34,571,293 (GRCm39) missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34,571,481 (GRCm39) nonsense probably null
R5414:Ifit1bl1 UTSW 19 34,571,324 (GRCm39) missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34,571,197 (GRCm39) nonsense probably null
R5586:Ifit1bl1 UTSW 19 34,571,677 (GRCm39) missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34,571,570 (GRCm39) nonsense probably null
R6382:Ifit1bl1 UTSW 19 34,572,283 (GRCm39) missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34,571,899 (GRCm39) missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34,576,667 (GRCm39) critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34,571,302 (GRCm39) missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34,571,564 (GRCm39) missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34,572,283 (GRCm39) missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34,571,405 (GRCm39) missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34,571,336 (GRCm39) missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34,571,224 (GRCm39) missense probably benign 0.00
R8251:Ifit1bl1 UTSW 19 34,572,232 (GRCm39) missense possibly damaging 0.85
R8427:Ifit1bl1 UTSW 19 34,576,666 (GRCm39) critical splice donor site probably null
R8474:Ifit1bl1 UTSW 19 34,572,262 (GRCm39) missense probably damaging 1.00
R8933:Ifit1bl1 UTSW 19 34,571,413 (GRCm39) missense probably damaging 0.99
R9095:Ifit1bl1 UTSW 19 34,571,899 (GRCm39) missense probably damaging 1.00
R9282:Ifit1bl1 UTSW 19 34,571,908 (GRCm39) missense probably benign 0.28
R9314:Ifit1bl1 UTSW 19 34,576,693 (GRCm39) missense probably benign 0.08
R9432:Ifit1bl1 UTSW 19 34,571,498 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTTTTACGCTGACAGCCTTC -3'
(R):5'- AGCCCTGCAGAGCTTGAAAG -3'

Sequencing Primer
(F):5'- CAGCCTTCTGTAAATGTTGGAGC -3'
(R):5'- TGAAGCCTTGATCCAGAGC -3'
Posted On 2015-10-08