Incidental Mutation 'R4616:Vsig1'
ID351079
Institutional Source Beutler Lab
Gene Symbol Vsig1
Ensembl Gene ENSMUSG00000031430
Gene NameV-set and immunoglobulin domain containing 1
Synonyms
MMRRC Submission 041827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4616 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location140907608-140939472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140926386 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 95 (A95S)
Ref Sequence ENSEMBL: ENSMUSP00000033806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033806]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033806
AA Change: A95S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033806
Gene: ENSMUSG00000031430
AA Change: A95S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 29 139 3.51e-8 SMART
IGc2 154 220 5.93e-6 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127629
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the junctional adhesion molecule (JAM) family. The encoded protein contains multiple glycosylation sites at the N-terminal region, and multiple phosphorylation sites and glutamic acid/proline (EP) repeats at the C-terminal region. The gene is expressed in normal stomach and testis, as well as in gastric, esophageal and ovarian cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Male chimeras hemizygous for a knock-out allele exhibit abnormal differentiation of gastric epithelia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,298,751 E123K probably damaging Het
4931417E11Rik A G 6: 73,469,269 V99A probably benign Het
Acod1 C T 14: 103,055,345 T435M probably benign Het
Adgrf5 T C 17: 43,452,440 F1078L probably benign Het
Adh6a A T 3: 138,324,947 N110I probably damaging Het
Aldh16a1 T C 7: 45,148,788 probably benign Het
Arhgef17 A G 7: 100,882,485 F1302S probably damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bpifa6 T C 2: 153,982,988 S28P possibly damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Cfb T A 17: 34,859,068 H962L probably benign Het
Chn2 G A 6: 54,290,403 M292I probably damaging Het
Clec16a T A 16: 10,644,883 probably null Het
Cyp1a1 T C 9: 57,701,756 S307P probably benign Het
Dsg3 T C 18: 20,531,559 V538A probably benign Het
Erbb3 G A 10: 128,572,770 Q815* probably null Het
Fam90a1a C A 8: 21,963,846 Q406K possibly damaging Het
Frmd3 T C 4: 74,187,872 V585A probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8214 T C 1: 183,681,897 noncoding transcript Het
Gpld1 G A 13: 24,984,816 G771D probably damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Gria2 A T 3: 80,706,897 I612N probably damaging Het
Ifit1bl1 T C 19: 34,594,610 E149G probably damaging Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Ighv2-9 G T 12: 113,879,219 T76K probably damaging Het
Igkv6-13 A T 6: 70,458,035 M1K probably null Het
Igkv8-21 A T 6: 70,315,157 S34T probably benign Het
Itpr1 A G 6: 108,481,223 N1985D probably damaging Het
Lama3 T C 18: 12,504,397 probably null Het
Lamc2 T C 1: 153,166,169 Y73C probably damaging Het
Maff A G 15: 79,357,698 D105G probably damaging Het
Mep1a C T 17: 43,486,241 V312M possibly damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrgbp A T 2: 180,585,314 silent Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Myo7b T C 18: 32,003,487 probably null Het
Myo9a T C 9: 59,821,649 I596T probably damaging Het
Olfr38 G T 6: 42,762,418 R122L probably benign Het
Olfr594 C T 7: 103,220,422 R235* probably null Het
Pcsk5 T G 19: 17,560,750 Q904H probably benign Het
Pdzrn3 G T 6: 101,152,009 H565Q probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pomgnt1 T A 4: 116,154,890 I337N probably damaging Het
Psmd3 T C 11: 98,682,926 V66A probably benign Het
Ptger3 T C 3: 157,567,294 S93P probably damaging Het
Rbm27 T A 18: 42,301,775 D301E probably damaging Het
Rdh16 A T 10: 127,801,513 probably null Het
Slc35a5 A T 16: 45,144,292 F193I probably benign Het
Slc4a4 A G 5: 89,038,561 K167R probably damaging Het
Sort1 A T 3: 108,355,541 T772S possibly damaging Het
Sptbn5 T A 2: 120,048,757 noncoding transcript Het
Stard5 G T 7: 83,633,281 probably benign Het
Tbc1d22a A G 15: 86,235,685 T61A probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Usp53 A T 3: 122,959,120 M80K probably damaging Het
Vmn1r209 A T 13: 22,805,965 L185Q probably damaging Het
Vmn2r59 A G 7: 42,012,438 I651T probably benign Het
Zfhx4 T C 3: 5,413,067 S3556P possibly damaging Het
Other mutations in Vsig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vsig1 APN X 140937680 missense possibly damaging 0.90
IGL03002:Vsig1 APN X 140926339 missense probably damaging 1.00
IGL03029:Vsig1 APN X 140926512 missense possibly damaging 0.55
R0383:Vsig1 UTSW X 140936313 missense possibly damaging 0.87
R4617:Vsig1 UTSW X 140926386 missense probably benign 0.01
R4618:Vsig1 UTSW X 140926386 missense probably benign 0.01
R4675:Vsig1 UTSW X 140933112 missense probably damaging 1.00
R7833:Vsig1 UTSW X 140933126 missense probably benign 0.01
R8039:Vsig1 UTSW X 140933126 missense probably benign 0.01
R8041:Vsig1 UTSW X 140933126 missense probably benign 0.01
R8042:Vsig1 UTSW X 140933126 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTCACTAAACTGAGAAATCTAG -3'
(R):5'- TTGATACTGTAGCCCAGAGACTTG -3'

Sequencing Primer
(F):5'- CTGAGAAATCTAGGCTCCCAGG -3'
(R):5'- GTAGCCCAGAGACTTGATTCATTCAC -3'
Posted On2015-10-08