Incidental Mutation 'R4617:Zfp451'
ID351080
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission 041828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4617 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 33802671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000044455] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000194656]
Predicted Effect probably benign
Transcript: ENSMUST00000019861
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000044455
AA Change: F377L
SMART Domains Protein: ENSMUSP00000044372
Gene: ENSMUSG00000042197
AA Change: F377L

DomainStartEndE-ValueType
low complexity region 92 98 N/A INTRINSIC
Pfam:LAP2alpha 344 499 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115167
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130376
SMART Domains Protein: ENSMUSP00000118047
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 30 56 1.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140163
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Meta Mutation Damage Score 0.2657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Acaa1a T A 9: 119,348,940 S279R probably damaging Het
Akr1cl A G 1: 65,021,391 C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 D301E probably benign Het
Arhgap11a G A 2: 113,834,078 T620M probably benign Het
Brinp1 A G 4: 68,762,961 I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 I760V probably benign Het
Cdh26 G A 2: 178,460,642 probably benign Het
Cpd A G 11: 76,840,615 L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 Y670H probably damaging Het
Disp2 G A 2: 118,790,162 M458I probably benign Het
Dot1l T C 10: 80,785,084 I563T probably damaging Het
Egf A T 3: 129,690,793 S1001T probably benign Het
Elfn1 A G 5: 139,972,009 Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 T725I probably benign Het
Fam168b A G 1: 34,819,982 V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 S443N probably damaging Het
Flrt2 T C 12: 95,780,229 V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 S58P probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8906 T C 5: 11,503,831 S7P probably benign Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Kdelc1 A C 1: 44,110,020 F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrpl38 T C 11: 116,132,452 D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 E430G probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Ogdhl A G 14: 32,325,885 R31G probably benign Het
Olfr275 A T 4: 52,825,399 M1L probably benign Het
Pcdh1 C A 18: 38,197,860 V697L probably benign Het
Pcdhga9 T C 18: 37,738,500 Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 Y625C probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Ptprn T A 1: 75,252,287 D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 W97R probably damaging Het
Rnf10 T A 5: 115,248,703 Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec24b A T 3: 130,040,764 S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 N100S probably benign Het
Stam2 A T 2: 52,715,704 D167E probably benign Het
Stambp G A 6: 83,561,978 Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 V556A possibly damaging Het
Tll2 T C 19: 41,098,636 D592G probably benign Het
Tmem199 A T 11: 78,509,682 probably benign Het
Traip T A 9: 107,970,019 N352K probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Usp54 C A 14: 20,550,338 A1444S probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Xdh G A 17: 73,918,394 T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 D83G probably damaging Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Zfp963 A T 8: 69,743,294 S170T probably benign Het
Zfp970 A G 2: 177,476,168 I512V probably benign Het
Zfp990 A G 4: 145,537,046 I205V possibly damaging Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 unclassified probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
R7774:Zfp451 UTSW 1 33805393 missense probably benign 0.20
R7835:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
R7918:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
RF005:Zfp451 UTSW 1 33776792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTACAGAGCTGCCAAAGTCC -3'
(R):5'- TGAGAATTGCCACCACTGAAG -3'

Sequencing Primer
(F):5'- TGCCAAAGTCCTGCATCCATG -3'
(R):5'- TAAAGACCCTGCTGATTGCC -3'
Posted On2015-10-08