Incidental Mutation 'R4617:Ccdc150'
ID 351083
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
MMRRC Submission 041828-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4617 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 54289842-54407886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54394913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 760 (I760V)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably benign
Transcript: ENSMUST00000027128
AA Change: I760V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: I760V

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159682
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163072
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,369,493 (GRCm39) I363V probably benign Het
Acaa1a T A 9: 119,178,006 (GRCm39) S279R probably damaging Het
Akr1cl A G 1: 65,060,550 (GRCm39) C156R probably damaging Het
Arhgap11a G A 2: 113,664,423 (GRCm39) T620M probably benign Het
Brinp1 A G 4: 68,681,198 (GRCm39) I444T possibly damaging Het
Cdh26 G A 2: 178,102,435 (GRCm39) probably benign Het
Cpd A G 11: 76,731,441 (GRCm39) L255P probably damaging Het
Cyfip2 A G 11: 46,144,845 (GRCm39) Y670H probably damaging Het
Disp2 G A 2: 118,620,643 (GRCm39) M458I probably benign Het
Dot1l T C 10: 80,620,918 (GRCm39) I563T probably damaging Het
Egf A T 3: 129,484,442 (GRCm39) S1001T probably benign Het
Elfn1 A G 5: 139,957,764 (GRCm39) Y256C probably damaging Het
Exoc4 C T 6: 33,839,139 (GRCm39) T725I probably benign Het
Fam168b A G 1: 34,859,063 (GRCm39) V72A possibly damaging Het
Fbxw20 C T 9: 109,046,631 (GRCm39) S443N probably damaging Het
Flacc1 A T 1: 58,700,601 (GRCm39) D301E probably benign Het
Flrt2 T C 12: 95,747,003 (GRCm39) V447A possibly damaging Het
Gm4846 A G 1: 166,323,550 (GRCm39) S58P probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Lpcat2b T C 5: 107,581,865 (GRCm39) L398P possibly damaging Het
Mapk8ip3 G A 17: 25,123,761 (GRCm39) P587L probably damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl38 T C 11: 116,023,278 (GRCm39) D325G probably damaging Het
Mtmr12 A G 15: 12,270,132 (GRCm39) E430G probably damaging Het
Mup18 T A 4: 61,590,154 (GRCm39) I125F possibly damaging Het
Ogdhl A G 14: 32,047,842 (GRCm39) R31G probably benign Het
Or13f5 A T 4: 52,825,399 (GRCm39) M1L probably benign Het
Pcdh1 C A 18: 38,330,913 (GRCm39) V697L probably benign Het
Pcdhga9 T C 18: 37,871,553 (GRCm39) Y461H probably damaging Het
Pdzrn4 A G 15: 92,667,723 (GRCm39) Y625C probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Poglut2 A C 1: 44,149,180 (GRCm39) F453V probably damaging Het
Ptprn T A 1: 75,228,931 (GRCm39) D828V possibly damaging Het
Rgs12 T A 5: 35,177,700 (GRCm39) W97R probably damaging Het
Rnf10 T A 5: 115,386,762 (GRCm39) Q508L probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sec24b A T 3: 129,834,413 (GRCm39) S126T possibly damaging Het
Slc6a5 A G 7: 49,561,768 (GRCm39) N100S probably benign Het
Speer1j T C 5: 11,553,798 (GRCm39) S7P probably benign Het
Stam2 A T 2: 52,605,716 (GRCm39) D167E probably benign Het
Stambp G A 6: 83,538,960 (GRCm39) Q147* probably null Het
Tbc1d32 A G 10: 56,047,000 (GRCm39) V556A possibly damaging Het
Tll2 T C 19: 41,087,075 (GRCm39) D592G probably benign Het
Tmem199 A T 11: 78,400,508 (GRCm39) probably benign Het
Traip T A 9: 107,847,218 (GRCm39) N352K probably benign Het
Trmt1l C T 1: 151,329,799 (GRCm39) Q581* probably null Het
Usp54 C A 14: 20,600,406 (GRCm39) A1444S probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Xdh G A 17: 74,225,389 (GRCm39) T471I probably damaging Het
Zdhhc19 A G 16: 32,316,494 (GRCm39) D83G probably damaging Het
Zfp352 A G 4: 90,113,318 (GRCm39) K486R probably benign Het
Zfp451 A G 1: 33,841,752 (GRCm39) probably benign Het
Zfp963 A T 8: 70,195,944 (GRCm39) S170T probably benign Het
Zfp970 A G 2: 177,167,961 (GRCm39) I512V probably benign Het
Zfp990 A G 4: 145,263,616 (GRCm39) I205V possibly damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54,311,709 (GRCm39) splice site probably benign
IGL00819:Ccdc150 APN 1 54,302,732 (GRCm39) missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54,339,647 (GRCm39) splice site probably null
IGL02352:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54,302,704 (GRCm39) nonsense probably null
IGL02673:Ccdc150 APN 1 54,368,149 (GRCm39) missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54,317,874 (GRCm39) missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54,339,482 (GRCm39) missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54,329,861 (GRCm39) missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0217:Ccdc150 UTSW 1 54,339,589 (GRCm39) missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54,368,670 (GRCm39) missense probably benign
R0687:Ccdc150 UTSW 1 54,324,790 (GRCm39) splice site probably null
R0790:Ccdc150 UTSW 1 54,316,935 (GRCm39) splice site probably benign
R1146:Ccdc150 UTSW 1 54,404,130 (GRCm39) splice site probably benign
R1288:Ccdc150 UTSW 1 54,403,617 (GRCm39) missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54,393,795 (GRCm39) missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54,407,069 (GRCm39) intron probably benign
R1957:Ccdc150 UTSW 1 54,303,068 (GRCm39) missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54,311,706 (GRCm39) critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54,404,084 (GRCm39) missense probably null 0.11
R3054:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54,407,469 (GRCm39) missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54,317,970 (GRCm39) missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54,392,213 (GRCm39) missense probably damaging 0.98
R4757:Ccdc150 UTSW 1 54,317,874 (GRCm39) missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54,404,027 (GRCm39) intron probably benign
R5028:Ccdc150 UTSW 1 54,302,636 (GRCm39) missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54,393,806 (GRCm39) missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54,302,779 (GRCm39) missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54,339,526 (GRCm39) missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54,316,873 (GRCm39) missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54,302,758 (GRCm39) missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54,407,176 (GRCm39) missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54,303,116 (GRCm39) splice site probably null
R6988:Ccdc150 UTSW 1 54,394,868 (GRCm39) nonsense probably null
R7248:Ccdc150 UTSW 1 54,344,057 (GRCm39) missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54,302,496 (GRCm39) splice site probably null
R7322:Ccdc150 UTSW 1 54,299,125 (GRCm39) missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54,339,541 (GRCm39) nonsense probably null
R7647:Ccdc150 UTSW 1 54,395,863 (GRCm39) missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54,407,551 (GRCm39) missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54,311,656 (GRCm39) missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54,368,646 (GRCm39) missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54,407,132 (GRCm39) missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54,302,668 (GRCm39) missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54,311,641 (GRCm39) missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54,311,644 (GRCm39) missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54,299,197 (GRCm39) missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54,316,910 (GRCm39) missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54,324,760 (GRCm39) missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54,317,990 (GRCm39) missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54,320,930 (GRCm39) missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54,407,544 (GRCm39) nonsense probably null
R9747:Ccdc150 UTSW 1 54,299,107 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTAATAATGCAGCCCGAGC -3'
(R):5'- AGGGTTGCCAGCTACCTTTG -3'

Sequencing Primer
(F):5'- GAGCTTCCAGAACAAAGGCATC -3'
(R):5'- GTTGCCAGCTACCTTTGAGATTATAC -3'
Posted On 2015-10-08