Incidental Mutation 'R4617:Trmt1l'
ID351090
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission 041828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4617 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 151454048 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 581 (Q581*)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
Predicted Effect probably null
Transcript: ENSMUST00000065625
AA Change: Q581*
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: Q581*

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Acaa1a T A 9: 119,348,940 S279R probably damaging Het
Akr1cl A G 1: 65,021,391 C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 D301E probably benign Het
Arhgap11a G A 2: 113,834,078 T620M probably benign Het
Brinp1 A G 4: 68,762,961 I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 I760V probably benign Het
Cdh26 G A 2: 178,460,642 probably benign Het
Cpd A G 11: 76,840,615 L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 Y670H probably damaging Het
Disp2 G A 2: 118,790,162 M458I probably benign Het
Dot1l T C 10: 80,785,084 I563T probably damaging Het
Egf A T 3: 129,690,793 S1001T probably benign Het
Elfn1 A G 5: 139,972,009 Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 T725I probably benign Het
Fam168b A G 1: 34,819,982 V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 S443N probably damaging Het
Flrt2 T C 12: 95,780,229 V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 S58P probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8906 T C 5: 11,503,831 S7P probably benign Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Kdelc1 A C 1: 44,110,020 F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrpl38 T C 11: 116,132,452 D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 E430G probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Ogdhl A G 14: 32,325,885 R31G probably benign Het
Olfr275 A T 4: 52,825,399 M1L probably benign Het
Pcdh1 C A 18: 38,197,860 V697L probably benign Het
Pcdhga9 T C 18: 37,738,500 Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 Y625C probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Ptprn T A 1: 75,252,287 D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 W97R probably damaging Het
Rnf10 T A 5: 115,248,703 Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec24b A T 3: 130,040,764 S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 N100S probably benign Het
Stam2 A T 2: 52,715,704 D167E probably benign Het
Stambp G A 6: 83,561,978 Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 V556A possibly damaging Het
Tll2 T C 19: 41,098,636 D592G probably benign Het
Tmem199 A T 11: 78,509,682 probably benign Het
Traip T A 9: 107,970,019 N352K probably benign Het
Usp54 C A 14: 20,550,338 A1444S probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Xdh G A 17: 73,918,394 T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 D83G probably damaging Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Zfp451 A G 1: 33,802,671 probably benign Het
Zfp963 A T 8: 69,743,294 S170T probably benign Het
Zfp970 A G 2: 177,476,168 I512V probably benign Het
Zfp990 A G 4: 145,537,046 I205V possibly damaging Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AAACATTTCTTTTCCAGGTCAAGTTCC -3'
(R):5'- AGAGGGTGACAGGCTTTGC -3'

Sequencing Primer
(F):5'- AGGTCAAGTTCCCTTTTCAATACTGG -3'
(R):5'- AGTGTATGCCCAGCACTCTG -3'
Posted On2015-10-08