Incidental Mutation 'R4617:Zfp352'
ID 351103
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission 041828-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4617 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 90218820-90225702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90225081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 486 (K486R)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect probably benign
Transcript: ENSMUST00000080541
AA Change: K486R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: K486R

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107129
AA Change: K486R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: K486R

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 (GRCm38) I363V probably benign Het
Acaa1a T A 9: 119,348,940 (GRCm38) S279R probably damaging Het
Akr1cl A G 1: 65,021,391 (GRCm38) C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 (GRCm38) D301E probably benign Het
Arhgap11a G A 2: 113,834,078 (GRCm38) T620M probably benign Het
Brinp1 A G 4: 68,762,961 (GRCm38) I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 (GRCm38) I760V probably benign Het
Cdh26 G A 2: 178,460,642 (GRCm38) probably benign Het
Cpd A G 11: 76,840,615 (GRCm38) L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 (GRCm38) Y670H probably damaging Het
Disp2 G A 2: 118,790,162 (GRCm38) M458I probably benign Het
Dot1l T C 10: 80,785,084 (GRCm38) I563T probably damaging Het
Egf A T 3: 129,690,793 (GRCm38) S1001T probably benign Het
Elfn1 A G 5: 139,972,009 (GRCm38) Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 (GRCm38) T725I probably benign Het
Fam168b A G 1: 34,819,982 (GRCm38) V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 (GRCm38) S443N probably damaging Het
Flrt2 T C 12: 95,780,229 (GRCm38) V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 (GRCm38) S58P probably damaging Het
Gm7102 C T 19: 61,175,926 (GRCm38) G24R unknown Het
Gm8906 T C 5: 11,503,831 (GRCm38) S7P probably benign Het
Gpr20 T C 15: 73,695,736 (GRCm38) N268S probably benign Het
Kdelc1 A C 1: 44,110,020 (GRCm38) F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 (GRCm38) L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 (GRCm38) P587L probably damaging Het
Mfap4 C A 11: 61,485,509 (GRCm38) probably benign Het
Mrpl38 T C 11: 116,132,452 (GRCm38) D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 (GRCm38) E430G probably damaging Het
Mup18 T A 4: 61,671,917 (GRCm38) I125F possibly damaging Het
Ogdhl A G 14: 32,325,885 (GRCm38) R31G probably benign Het
Olfr275 A T 4: 52,825,399 (GRCm38) M1L probably benign Het
Pcdh1 C A 18: 38,197,860 (GRCm38) V697L probably benign Het
Pcdhga9 T C 18: 37,738,500 (GRCm38) Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 (GRCm38) Y625C probably damaging Het
Pkd2l1 C A 19: 44,154,134 (GRCm38) A490S probably damaging Het
Ptprn T A 1: 75,252,287 (GRCm38) D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 (GRCm38) W97R probably damaging Het
Rnf10 T A 5: 115,248,703 (GRCm38) Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 (GRCm38) C537R probably damaging Het
Sec24b A T 3: 130,040,764 (GRCm38) S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 (GRCm38) N100S probably benign Het
Stam2 A T 2: 52,715,704 (GRCm38) D167E probably benign Het
Stambp G A 6: 83,561,978 (GRCm38) Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 (GRCm38) V556A possibly damaging Het
Tll2 T C 19: 41,098,636 (GRCm38) D592G probably benign Het
Tmem199 A T 11: 78,509,682 (GRCm38) probably benign Het
Traip T A 9: 107,970,019 (GRCm38) N352K probably benign Het
Trmt1l C T 1: 151,454,048 (GRCm38) Q581* probably null Het
Usp54 C A 14: 20,550,338 (GRCm38) A1444S probably benign Het
Vsig1 G T X: 140,926,386 (GRCm38) A95S probably benign Het
Xdh G A 17: 73,918,394 (GRCm38) T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 (GRCm38) D83G probably damaging Het
Zfp451 A G 1: 33,802,671 (GRCm38) probably benign Het
Zfp963 A T 8: 69,743,294 (GRCm38) S170T probably benign Het
Zfp970 A G 2: 177,476,168 (GRCm38) I512V probably benign Het
Zfp990 A G 4: 145,537,046 (GRCm38) I205V possibly damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90,224,154 (GRCm38) missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90,224,130 (GRCm38) missense probably benign 0.02
IGL03156:Zfp352 APN 4 90,224,087 (GRCm38) missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90,224,702 (GRCm38) missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90,223,757 (GRCm38) missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90,224,346 (GRCm38) missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90,224,285 (GRCm38) missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90,225,009 (GRCm38) missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90,224,690 (GRCm38) missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90,223,919 (GRCm38) missense probably benign
R1034:Zfp352 UTSW 4 90,224,156 (GRCm38) missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90,223,809 (GRCm38) missense probably benign 0.23
R2016:Zfp352 UTSW 4 90,225,171 (GRCm38) missense probably benign 0.42
R2064:Zfp352 UTSW 4 90,225,120 (GRCm38) missense probably benign 0.08
R2308:Zfp352 UTSW 4 90,225,243 (GRCm38) missense probably benign 0.00
R3552:Zfp352 UTSW 4 90,225,102 (GRCm38) missense probably benign 0.33
R3794:Zfp352 UTSW 4 90,225,149 (GRCm38) missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90,225,149 (GRCm38) missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90,225,024 (GRCm38) missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90,223,834 (GRCm38) missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90,225,164 (GRCm38) missense probably benign 0.00
R4590:Zfp352 UTSW 4 90,224,535 (GRCm38) missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90,225,081 (GRCm38) missense probably benign 0.00
R4618:Zfp352 UTSW 4 90,225,081 (GRCm38) missense probably benign 0.00
R4741:Zfp352 UTSW 4 90,224,940 (GRCm38) missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90,224,304 (GRCm38) missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90,224,139 (GRCm38) missense probably benign 0.01
R4973:Zfp352 UTSW 4 90,224,139 (GRCm38) missense probably benign 0.01
R5167:Zfp352 UTSW 4 90,224,216 (GRCm38) missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90,224,460 (GRCm38) missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90,225,104 (GRCm38) missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90,225,070 (GRCm38) missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90,225,200 (GRCm38) missense probably benign 0.33
R6819:Zfp352 UTSW 4 90,224,699 (GRCm38) missense probably benign
R7072:Zfp352 UTSW 4 90,224,424 (GRCm38) missense probably benign 0.00
R7099:Zfp352 UTSW 4 90,224,880 (GRCm38) missense probably benign 0.00
R7569:Zfp352 UTSW 4 90,223,659 (GRCm38) missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90,224,777 (GRCm38) missense probably benign 0.13
R7705:Zfp352 UTSW 4 90,225,275 (GRCm38) missense possibly damaging 0.94
R8424:Zfp352 UTSW 4 90,224,243 (GRCm38) missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90,224,881 (GRCm38) missense probably benign 0.38
R9378:Zfp352 UTSW 4 90,224,338 (GRCm38) missense probably benign 0.13
R9509:Zfp352 UTSW 4 90,224,706 (GRCm38) missense probably damaging 0.99
R9623:Zfp352 UTSW 4 90,224,891 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTGGGTGAATCCTCATACCC -3'
(R):5'- AGCATGTTTCTTCTCCAGATGC -3'

Sequencing Primer
(F):5'- TCGGCTTCCAGTTTAGTCCAGAG -3'
(R):5'- CCAGATGCTTTTTGAGATAAAGCAG -3'
Posted On 2015-10-08