Incidental Mutation 'R4617:Zfp990'
ID 351104
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Name zinc finger protein 990
Synonyms Gm13225
MMRRC Submission 041828-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4617 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 145237329-145265751 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145263616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 205 (I205V)
Ref Sequence ENSEMBL: ENSMUSP00000101368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
AlphaFold B1AVN5
Predicted Effect possibly damaging
Transcript: ENSMUST00000105741
AA Change: I205V

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: I205V

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105742
AA Change: I205V

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: I205V

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136309
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,369,493 (GRCm39) I363V probably benign Het
Acaa1a T A 9: 119,178,006 (GRCm39) S279R probably damaging Het
Akr1cl A G 1: 65,060,550 (GRCm39) C156R probably damaging Het
Arhgap11a G A 2: 113,664,423 (GRCm39) T620M probably benign Het
Brinp1 A G 4: 68,681,198 (GRCm39) I444T possibly damaging Het
Ccdc150 A G 1: 54,394,913 (GRCm39) I760V probably benign Het
Cdh26 G A 2: 178,102,435 (GRCm39) probably benign Het
Cpd A G 11: 76,731,441 (GRCm39) L255P probably damaging Het
Cyfip2 A G 11: 46,144,845 (GRCm39) Y670H probably damaging Het
Disp2 G A 2: 118,620,643 (GRCm39) M458I probably benign Het
Dot1l T C 10: 80,620,918 (GRCm39) I563T probably damaging Het
Egf A T 3: 129,484,442 (GRCm39) S1001T probably benign Het
Elfn1 A G 5: 139,957,764 (GRCm39) Y256C probably damaging Het
Exoc4 C T 6: 33,839,139 (GRCm39) T725I probably benign Het
Fam168b A G 1: 34,859,063 (GRCm39) V72A possibly damaging Het
Fbxw20 C T 9: 109,046,631 (GRCm39) S443N probably damaging Het
Flacc1 A T 1: 58,700,601 (GRCm39) D301E probably benign Het
Flrt2 T C 12: 95,747,003 (GRCm39) V447A possibly damaging Het
Gm4846 A G 1: 166,323,550 (GRCm39) S58P probably damaging Het
Gpr20 T C 15: 73,567,585 (GRCm39) N268S probably benign Het
Lpcat2b T C 5: 107,581,865 (GRCm39) L398P possibly damaging Het
Mapk8ip3 G A 17: 25,123,761 (GRCm39) P587L probably damaging Het
Mfap4 C A 11: 61,376,335 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl38 T C 11: 116,023,278 (GRCm39) D325G probably damaging Het
Mtmr12 A G 15: 12,270,132 (GRCm39) E430G probably damaging Het
Mup18 T A 4: 61,590,154 (GRCm39) I125F possibly damaging Het
Ogdhl A G 14: 32,047,842 (GRCm39) R31G probably benign Het
Or13f5 A T 4: 52,825,399 (GRCm39) M1L probably benign Het
Pcdh1 C A 18: 38,330,913 (GRCm39) V697L probably benign Het
Pcdhga9 T C 18: 37,871,553 (GRCm39) Y461H probably damaging Het
Pdzrn4 A G 15: 92,667,723 (GRCm39) Y625C probably damaging Het
Pkd2l1 C A 19: 44,142,573 (GRCm39) A490S probably damaging Het
Poglut2 A C 1: 44,149,180 (GRCm39) F453V probably damaging Het
Ptprn T A 1: 75,228,931 (GRCm39) D828V possibly damaging Het
Rgs12 T A 5: 35,177,700 (GRCm39) W97R probably damaging Het
Rnf10 T A 5: 115,386,762 (GRCm39) Q508L probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sec24b A T 3: 129,834,413 (GRCm39) S126T possibly damaging Het
Slc6a5 A G 7: 49,561,768 (GRCm39) N100S probably benign Het
Speer1j T C 5: 11,553,798 (GRCm39) S7P probably benign Het
Stam2 A T 2: 52,605,716 (GRCm39) D167E probably benign Het
Stambp G A 6: 83,538,960 (GRCm39) Q147* probably null Het
Tbc1d32 A G 10: 56,047,000 (GRCm39) V556A possibly damaging Het
Tll2 T C 19: 41,087,075 (GRCm39) D592G probably benign Het
Tmem199 A T 11: 78,400,508 (GRCm39) probably benign Het
Traip T A 9: 107,847,218 (GRCm39) N352K probably benign Het
Trmt1l C T 1: 151,329,799 (GRCm39) Q581* probably null Het
Usp54 C A 14: 20,600,406 (GRCm39) A1444S probably benign Het
Vsig1 G T X: 139,827,135 (GRCm39) A95S probably benign Het
Xdh G A 17: 74,225,389 (GRCm39) T471I probably damaging Het
Zdhhc19 A G 16: 32,316,494 (GRCm39) D83G probably damaging Het
Zfp352 A G 4: 90,113,318 (GRCm39) K486R probably benign Het
Zfp451 A G 1: 33,841,752 (GRCm39) probably benign Het
Zfp963 A T 8: 70,195,944 (GRCm39) S170T probably benign Het
Zfp970 A G 2: 177,167,961 (GRCm39) I512V probably benign Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145,264,438 (GRCm39) missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145,263,518 (GRCm39) missense probably benign 0.28
IGL01895:Zfp990 APN 4 145,263,428 (GRCm39) missense probably damaging 0.99
IGL01895:Zfp990 APN 4 145,263,427 (GRCm39) missense probably damaging 0.97
IGL02349:Zfp990 APN 4 145,257,447 (GRCm39) utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145,263,533 (GRCm39) missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145,261,492 (GRCm39) splice site probably null
IGL03026:Zfp990 APN 4 145,263,680 (GRCm39) missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145,264,008 (GRCm39) missense probably benign 0.00
R0352:Zfp990 UTSW 4 145,263,174 (GRCm39) missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145,263,872 (GRCm39) missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145,263,853 (GRCm39) missense probably benign 0.44
R1537:Zfp990 UTSW 4 145,263,566 (GRCm39) missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145,264,780 (GRCm39) missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145,261,452 (GRCm39) missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145,263,439 (GRCm39) missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145,263,974 (GRCm39) missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145,263,892 (GRCm39) missense possibly damaging 0.94
R2235:Zfp990 UTSW 4 145,264,461 (GRCm39) missense probably damaging 0.99
R4194:Zfp990 UTSW 4 145,263,547 (GRCm39) splice site probably null
R4195:Zfp990 UTSW 4 145,263,547 (GRCm39) splice site probably null
R4418:Zfp990 UTSW 4 145,263,298 (GRCm39) missense possibly damaging 0.87
R4736:Zfp990 UTSW 4 145,263,512 (GRCm39) missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145,264,490 (GRCm39) missense probably benign
R4941:Zfp990 UTSW 4 145,263,407 (GRCm39) missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145,264,669 (GRCm39) missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145,264,613 (GRCm39) missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145,264,483 (GRCm39) missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145,264,359 (GRCm39) missense probably benign 0.00
R6267:Zfp990 UTSW 4 145,264,673 (GRCm39) missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145,264,673 (GRCm39) missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145,264,138 (GRCm39) missense probably benign 0.00
R6616:Zfp990 UTSW 4 145,263,715 (GRCm39) missense probably benign 0.01
R6701:Zfp990 UTSW 4 145,264,748 (GRCm39) missense probably benign 0.45
R6720:Zfp990 UTSW 4 145,263,497 (GRCm39) missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145,263,205 (GRCm39) missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145,264,157 (GRCm39) missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145,263,532 (GRCm39) missense possibly damaging 0.86
R8749:Zfp990 UTSW 4 145,264,156 (GRCm39) missense probably damaging 0.96
R8785:Zfp990 UTSW 4 145,264,246 (GRCm39) missense probably benign 0.00
R9161:Zfp990 UTSW 4 145,261,509 (GRCm39) missense possibly damaging 0.71
R9211:Zfp990 UTSW 4 145,264,171 (GRCm39) missense probably damaging 0.98
Z1176:Zfp990 UTSW 4 145,263,381 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCAGGAACACTAAAGAAGTTTG -3'
(R):5'- GACTACATTTGTGAGGTGTCTCTCC -3'

Sequencing Primer
(F):5'- GTGTCAATCAAGGAATTTACATGCAG -3'
(R):5'- TGAGGTGTCTCTCCTTTATGAATTC -3'
Posted On 2015-10-08