Incidental Mutation 'R4617:Ogdhl'
ID351129
Institutional Source Beutler Lab
Gene Symbol Ogdhl
Ensembl Gene ENSMUSG00000021913
Gene Nameoxoglutarate dehydrogenase-like
Synonyms
MMRRC Submission 041828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4617 (G1)
Quality Score209
Status Validated
Chromosome14
Chromosomal Location32322019-32348151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32325885 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 31 (R31G)
Ref Sequence ENSEMBL: ENSMUSP00000154185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022480] [ENSMUST00000228529]
Predicted Effect probably benign
Transcript: ENSMUST00000022480
AA Change: R31G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022480
Gene: ENSMUSG00000021913
AA Change: R31G

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 44 81 2.7e-18 PFAM
Blast:Transket_pyr 118 154 8e-14 BLAST
Pfam:E1_dh 262 588 1.8e-88 PFAM
Transket_pyr 657 870 2.64e-51 SMART
Pfam:OxoGdeHyase_C 874 1019 8.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228286
Predicted Effect probably benign
Transcript: ENSMUST00000228529
AA Change: R31G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to oxoglutarate dehydrogenase (OGDH) of the OGDH complex, which degrades glucose and glutamate. This gene encodes several isoforms, including some that appear to localize to mitochondria. The encoded protein down-regulates the AKT signaling cascade and can suppress the growth of cervical cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Acaa1a T A 9: 119,348,940 S279R probably damaging Het
Akr1cl A G 1: 65,021,391 C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 D301E probably benign Het
Arhgap11a G A 2: 113,834,078 T620M probably benign Het
Brinp1 A G 4: 68,762,961 I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 I760V probably benign Het
Cdh26 G A 2: 178,460,642 probably benign Het
Cpd A G 11: 76,840,615 L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 Y670H probably damaging Het
Disp2 G A 2: 118,790,162 M458I probably benign Het
Dot1l T C 10: 80,785,084 I563T probably damaging Het
Egf A T 3: 129,690,793 S1001T probably benign Het
Elfn1 A G 5: 139,972,009 Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 T725I probably benign Het
Fam168b A G 1: 34,819,982 V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 S443N probably damaging Het
Flrt2 T C 12: 95,780,229 V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 S58P probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8906 T C 5: 11,503,831 S7P probably benign Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Kdelc1 A C 1: 44,110,020 F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrpl38 T C 11: 116,132,452 D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 E430G probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Olfr275 A T 4: 52,825,399 M1L probably benign Het
Pcdh1 C A 18: 38,197,860 V697L probably benign Het
Pcdhga9 T C 18: 37,738,500 Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 Y625C probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Ptprn T A 1: 75,252,287 D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 W97R probably damaging Het
Rnf10 T A 5: 115,248,703 Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec24b A T 3: 130,040,764 S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 N100S probably benign Het
Stam2 A T 2: 52,715,704 D167E probably benign Het
Stambp G A 6: 83,561,978 Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 V556A possibly damaging Het
Tll2 T C 19: 41,098,636 D592G probably benign Het
Tmem199 A T 11: 78,509,682 probably benign Het
Traip T A 9: 107,970,019 N352K probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Usp54 C A 14: 20,550,338 A1444S probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Xdh G A 17: 73,918,394 T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 D83G probably damaging Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Zfp451 A G 1: 33,802,671 probably benign Het
Zfp963 A T 8: 69,743,294 S170T probably benign Het
Zfp970 A G 2: 177,476,168 I512V probably benign Het
Zfp990 A G 4: 145,537,046 I205V possibly damaging Het
Other mutations in Ogdhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ogdhl APN 14 32333712 missense probably damaging 1.00
IGL00425:Ogdhl APN 14 32346490 missense probably damaging 1.00
IGL01509:Ogdhl APN 14 32337759 missense probably damaging 1.00
IGL01704:Ogdhl APN 14 32337631 splice site probably benign
IGL01760:Ogdhl APN 14 32339937 missense probably damaging 1.00
IGL02376:Ogdhl APN 14 32343318 missense probably damaging 1.00
IGL02508:Ogdhl APN 14 32345174 missense probably damaging 0.99
IGL02834:Ogdhl APN 14 32325946 missense probably damaging 1.00
IGL03100:Ogdhl APN 14 32342072 missense probably benign 0.03
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0207:Ogdhl UTSW 14 32342037 splice site probably null
R0322:Ogdhl UTSW 14 32337577 missense probably benign 0.09
R0357:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R0417:Ogdhl UTSW 14 32326979 missense probably damaging 1.00
R0677:Ogdhl UTSW 14 32339925 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1541:Ogdhl UTSW 14 32340667 missense possibly damaging 0.80
R1589:Ogdhl UTSW 14 32325865 missense probably benign
R1831:Ogdhl UTSW 14 32337527 missense probably damaging 0.99
R2059:Ogdhl UTSW 14 32332884 missense probably damaging 1.00
R2133:Ogdhl UTSW 14 32325934 missense probably benign
R2179:Ogdhl UTSW 14 32335345 missense probably damaging 0.99
R2656:Ogdhl UTSW 14 32332826 missense possibly damaging 0.89
R3607:Ogdhl UTSW 14 32335361 missense probably damaging 1.00
R4668:Ogdhl UTSW 14 32332536 missense probably benign 0.00
R5419:Ogdhl UTSW 14 32339224 missense probably damaging 1.00
R5575:Ogdhl UTSW 14 32325847 missense possibly damaging 0.60
R5793:Ogdhl UTSW 14 32332773 missense probably damaging 0.96
R5812:Ogdhl UTSW 14 32332865 missense probably damaging 1.00
R5990:Ogdhl UTSW 14 32327114 missense possibly damaging 0.77
R6224:Ogdhl UTSW 14 32342061 missense probably benign 0.09
R7834:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7837:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R7917:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7920:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
Z1177:Ogdhl UTSW 14 32343280 missense probably damaging 1.00
Z1177:Ogdhl UTSW 14 32346411 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CATAGGGGTTAGGAGTGAACTC -3'
(R):5'- AGGTCATGGCTGGTTCTCAC -3'

Sequencing Primer
(F):5'- TTAGGAGTGAACTCGGACATATCC -3'
(R):5'- ATGGCTGGTTCTCACAATCC -3'
Posted On2015-10-08