Incidental Mutation 'R4617:Pcdh1'
ID351138
Institutional Source Beutler Lab
Gene Symbol Pcdh1
Ensembl Gene ENSMUSG00000051375
Gene Nameprotocadherin 1
Synonyms2010005A06Rik
MMRRC Submission 041828-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R4617 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38185914-38212053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38197860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 697 (V697L)
Ref Sequence ENSEMBL: ENSMUSP00000125576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057185] [ENSMUST00000159405] [ENSMUST00000160721] [ENSMUST00000161701]
Predicted Effect probably benign
Transcript: ENSMUST00000057185
AA Change: V836L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055199
Gene: ENSMUSG00000051375
AA Change: V836L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159405
AA Change: V836L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125309
Gene: ENSMUSG00000051375
AA Change: V836L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160721
SMART Domains Protein: ENSMUSP00000124732
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 9.9e-10 PFAM
CA 168 256 5.18e-18 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161701
AA Change: V697L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125576
Gene: ENSMUSG00000051375
AA Change: V697L

DomainStartEndE-ValueType
CA 29 117 5.18e-18 SMART
CA 141 224 5.68e-24 SMART
CA 256 343 1.84e-23 SMART
CA 367 449 2.99e-32 SMART
CA 473 552 9.36e-25 SMART
CA 578 659 9.9e-15 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 737 764 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 903 914 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
Meta Mutation Damage Score 0.0978 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Acaa1a T A 9: 119,348,940 S279R probably damaging Het
Akr1cl A G 1: 65,021,391 C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 D301E probably benign Het
Arhgap11a G A 2: 113,834,078 T620M probably benign Het
Brinp1 A G 4: 68,762,961 I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 I760V probably benign Het
Cdh26 G A 2: 178,460,642 probably benign Het
Cpd A G 11: 76,840,615 L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 Y670H probably damaging Het
Disp2 G A 2: 118,790,162 M458I probably benign Het
Dot1l T C 10: 80,785,084 I563T probably damaging Het
Egf A T 3: 129,690,793 S1001T probably benign Het
Elfn1 A G 5: 139,972,009 Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 T725I probably benign Het
Fam168b A G 1: 34,819,982 V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 S443N probably damaging Het
Flrt2 T C 12: 95,780,229 V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 S58P probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8906 T C 5: 11,503,831 S7P probably benign Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Kdelc1 A C 1: 44,110,020 F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrpl38 T C 11: 116,132,452 D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 E430G probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Ogdhl A G 14: 32,325,885 R31G probably benign Het
Olfr275 A T 4: 52,825,399 M1L probably benign Het
Pcdhga9 T C 18: 37,738,500 Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 Y625C probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Ptprn T A 1: 75,252,287 D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 W97R probably damaging Het
Rnf10 T A 5: 115,248,703 Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec24b A T 3: 130,040,764 S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 N100S probably benign Het
Stam2 A T 2: 52,715,704 D167E probably benign Het
Stambp G A 6: 83,561,978 Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 V556A possibly damaging Het
Tll2 T C 19: 41,098,636 D592G probably benign Het
Tmem199 A T 11: 78,509,682 probably benign Het
Traip T A 9: 107,970,019 N352K probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Usp54 C A 14: 20,550,338 A1444S probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Xdh G A 17: 73,918,394 T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 D83G probably damaging Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Zfp451 A G 1: 33,802,671 probably benign Het
Zfp963 A T 8: 69,743,294 S170T probably benign Het
Zfp970 A G 2: 177,476,168 I512V probably benign Het
Zfp990 A G 4: 145,537,046 I205V possibly damaging Het
Other mutations in Pcdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdh1 APN 18 38198729 missense possibly damaging 0.65
IGL00919:Pcdh1 APN 18 38202812 nonsense probably null
IGL01744:Pcdh1 APN 18 38203249 missense probably damaging 1.00
PIT4260001:Pcdh1 UTSW 18 38203366 missense probably damaging 0.99
R0542:Pcdh1 UTSW 18 38189922 missense probably damaging 0.99
R1449:Pcdh1 UTSW 18 38189876 missense probably damaging 0.99
R1540:Pcdh1 UTSW 18 38189726 missense probably benign 0.01
R1642:Pcdh1 UTSW 18 38199230 missense possibly damaging 0.84
R1672:Pcdh1 UTSW 18 38192180 missense probably damaging 1.00
R1695:Pcdh1 UTSW 18 38202868 missense probably damaging 1.00
R1727:Pcdh1 UTSW 18 38203032 nonsense probably null
R1781:Pcdh1 UTSW 18 38189924 missense probably damaging 1.00
R1793:Pcdh1 UTSW 18 38198885 missense probably damaging 0.99
R1839:Pcdh1 UTSW 18 38199485 missense possibly damaging 0.82
R1843:Pcdh1 UTSW 18 38192225 splice site probably null
R1882:Pcdh1 UTSW 18 38202842 missense possibly damaging 0.49
R2261:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2262:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2263:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2511:Pcdh1 UTSW 18 38199479 missense possibly damaging 0.95
R2937:Pcdh1 UTSW 18 38189762 missense probably benign 0.40
R3941:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R3942:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R4057:Pcdh1 UTSW 18 38198897 missense probably damaging 0.98
R4155:Pcdh1 UTSW 18 38203106 missense probably damaging 0.99
R4169:Pcdh1 UTSW 18 38198305 missense probably damaging 1.00
R4690:Pcdh1 UTSW 18 38203475 missense probably benign 0.33
R4825:Pcdh1 UTSW 18 38189859 missense possibly damaging 0.77
R5201:Pcdh1 UTSW 18 38198918 missense probably damaging 0.98
R5266:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5267:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5351:Pcdh1 UTSW 18 38197766 missense probably damaging 1.00
R5568:Pcdh1 UTSW 18 38197367 missense probably damaging 1.00
R5729:Pcdh1 UTSW 18 38202946 missense probably damaging 1.00
R5731:Pcdh1 UTSW 18 38198598 missense probably damaging 1.00
R6043:Pcdh1 UTSW 18 38203274 missense probably damaging 0.97
R6278:Pcdh1 UTSW 18 38199210 missense probably benign 0.29
R6333:Pcdh1 UTSW 18 38198807 missense probably benign 0.25
R6498:Pcdh1 UTSW 18 38197437 missense probably benign 0.18
R6937:Pcdh1 UTSW 18 38203475 missense possibly damaging 0.86
R6994:Pcdh1 UTSW 18 38198500 missense probably damaging 1.00
R7242:Pcdh1 UTSW 18 38203217 missense probably benign 0.06
R7289:Pcdh1 UTSW 18 38189913 missense probably damaging 0.99
R7391:Pcdh1 UTSW 18 38202785 missense possibly damaging 0.95
R7702:Pcdh1 UTSW 18 38203516 missense unknown
R7738:Pcdh1 UTSW 18 38197476 missense probably benign 0.02
R7849:Pcdh1 UTSW 18 38189609 missense probably benign 0.01
R7941:Pcdh1 UTSW 18 38199080 missense probably damaging 1.00
R8109:Pcdh1 UTSW 18 38198996 missense probably damaging 1.00
R8675:Pcdh1 UTSW 18 38199176 missense probably damaging 1.00
X0027:Pcdh1 UTSW 18 38189788 nonsense probably null
Z1088:Pcdh1 UTSW 18 38198067 missense probably damaging 1.00
Z1176:Pcdh1 UTSW 18 38198688 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCACAGGTTTCGGTGACTTGC -3'
(R):5'- TCGTGGTGAAGGTCAGTGAC -3'

Sequencing Primer
(F):5'- ACAGGTTTCGGTGACTTGCTTTTC -3'
(R):5'- TCAGTGACCGTGGCAAGC -3'
Posted On2015-10-08