Incidental Mutation 'R4617:Pkd2l1'
ID351140
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 041828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4617 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44154134 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 490 (A490S)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably damaging
Transcript: ENSMUST00000042026
AA Change: A490S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: A490S

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Acaa1a T A 9: 119,348,940 S279R probably damaging Het
Akr1cl A G 1: 65,021,391 C156R probably damaging Het
Als2cr12 A T 1: 58,661,442 D301E probably benign Het
Arhgap11a G A 2: 113,834,078 T620M probably benign Het
Brinp1 A G 4: 68,762,961 I444T possibly damaging Het
Ccdc150 A G 1: 54,355,754 I760V probably benign Het
Cdh26 G A 2: 178,460,642 probably benign Het
Cpd A G 11: 76,840,615 L255P probably damaging Het
Cyfip2 A G 11: 46,254,018 Y670H probably damaging Het
Disp2 G A 2: 118,790,162 M458I probably benign Het
Dot1l T C 10: 80,785,084 I563T probably damaging Het
Egf A T 3: 129,690,793 S1001T probably benign Het
Elfn1 A G 5: 139,972,009 Y256C probably damaging Het
Exoc4 C T 6: 33,862,204 T725I probably benign Het
Fam168b A G 1: 34,819,982 V72A possibly damaging Het
Fbxw20 C T 9: 109,217,563 S443N probably damaging Het
Flrt2 T C 12: 95,780,229 V447A possibly damaging Het
Gm4846 A G 1: 166,495,981 S58P probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm8906 T C 5: 11,503,831 S7P probably benign Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Kdelc1 A C 1: 44,110,020 F453V probably damaging Het
Lpcat2b T C 5: 107,433,999 L398P possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Mfap4 C A 11: 61,485,509 probably benign Het
Mrpl38 T C 11: 116,132,452 D325G probably damaging Het
Mtmr12 A G 15: 12,270,046 E430G probably damaging Het
Mup18 T A 4: 61,671,917 I125F possibly damaging Het
Ogdhl A G 14: 32,325,885 R31G probably benign Het
Olfr275 A T 4: 52,825,399 M1L probably benign Het
Pcdh1 C A 18: 38,197,860 V697L probably benign Het
Pcdhga9 T C 18: 37,738,500 Y461H probably damaging Het
Pdzrn4 A G 15: 92,769,842 Y625C probably damaging Het
Ptprn T A 1: 75,252,287 D828V possibly damaging Het
Rgs12 T A 5: 35,020,356 W97R probably damaging Het
Rnf10 T A 5: 115,248,703 Q508L probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec24b A T 3: 130,040,764 S126T possibly damaging Het
Slc6a5 A G 7: 49,912,020 N100S probably benign Het
Stam2 A T 2: 52,715,704 D167E probably benign Het
Stambp G A 6: 83,561,978 Q147* probably null Het
Tbc1d32 A G 10: 56,170,904 V556A possibly damaging Het
Tll2 T C 19: 41,098,636 D592G probably benign Het
Tmem199 A T 11: 78,509,682 probably benign Het
Traip T A 9: 107,970,019 N352K probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Usp54 C A 14: 20,550,338 A1444S probably benign Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Xdh G A 17: 73,918,394 T471I probably damaging Het
Zdhhc19 A G 16: 32,497,676 D83G probably damaging Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Zfp451 A G 1: 33,802,671 probably benign Het
Zfp963 A T 8: 69,743,294 S170T probably benign Het
Zfp970 A G 2: 177,476,168 I512V probably benign Het
Zfp990 A G 4: 145,537,046 I205V possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAAATTACTCGAGAGC -3'
(R):5'- TCTGTCCGTTCCTGGAGTAGTC -3'

Sequencing Primer
(F):5'- GCAGCTGCACTCAGATACCTTTAAG -3'
(R):5'- CCGTTCCTGGAGTAGTCTATGC -3'
Posted On2015-10-08