Mutagenetix > Incidental Mutation

Incidental Mutation 'R3981:Mfap2'

351158

Institutional Source

Beutler Lab

Gene Symbol

Mfap2

Ensembl Gene

ENSMUSG00000060572

Gene Name

microfibrillar-associated protein 2

Synonyms

Magp

MMRRC Submission

040943-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R3981 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140737735-140743286 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140741554 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 71 (Q71R)

Ref Sequence

ENSEMBL: ENSMUSP00000132711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000071977] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000166376] [ENSMUST00000168157]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000040222

SMART Domains

Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071977
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071868
Gene: ENSMUSG00000060572
AA Change: Q71R

Domain	Start	End	E-Value	Type
Pfam:MAGP	3	153	1.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097816

SMART Domains

Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102491

SMART Domains

Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	77	93	N/A	INTRINSIC
Pfam:Rootletin	158	336	9.7e-65	PFAM
low complexity region	354	381	N/A	INTRINSIC
internal_repeat_2	462	479	1.77e-6	PROSPERO
low complexity region	493	514	N/A	INTRINSIC
internal_repeat_3	527	557	8.63e-6	PROSPERO
internal_repeat_6	533	556	4.21e-5	PROSPERO
low complexity region	561	575	N/A	INTRINSIC
low complexity region	576	594	N/A	INTRINSIC
low complexity region	617	638	N/A	INTRINSIC
low complexity region	788	807	N/A	INTRINSIC
low complexity region	863	880	N/A	INTRINSIC
low complexity region	1009	1039	N/A	INTRINSIC
internal_repeat_4	1050	1068	4.21e-5	PROSPERO
internal_repeat_7	1057	1070	9.31e-5	PROSPERO
internal_repeat_2	1057	1074	1.77e-6	PROSPERO
internal_repeat_4	1061	1078	4.21e-5	PROSPERO
internal_repeat_1	1076	1101	3.36e-8	PROSPERO
internal_repeat_7	1192	1205	9.31e-5	PROSPERO
low complexity region	1271	1288	N/A	INTRINSIC
internal_repeat_5	1302	1328	4.21e-5	PROSPERO
low complexity region	1354	1365	N/A	INTRINSIC
low complexity region	1417	1433	N/A	INTRINSIC
low complexity region	1434	1453	N/A	INTRINSIC
low complexity region	1461	1473	N/A	INTRINSIC
internal_repeat_6	1697	1720	4.21e-5	PROSPERO
low complexity region	1723	1740	N/A	INTRINSIC
coiled coil region	1744	1871	N/A	INTRINSIC
coiled coil region	1892	1996	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122846

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124506

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126973

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166376
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132711
Gene: ENSMUSG00000060572
AA Change: Q71R

Domain	Start	End	E-Value	Type
Pfam:MAGP	2	153	2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151455

Predicted Effect

probably benign
Transcript: ENSMUST00000168157

SMART Domains

Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a knock-out allele show thrombocytopenia, delayed thrombotic occlusion following vessel injury, and prolonged bleeding from a tail vein incision. Homozygotes for a different knock-out allele exhibit marrow adipose tissue expansion, insulin resistance, and altered basal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,482,407 (GRCm39)	C4313G	probably benign	Het
Alkbh2	C	T	5: 114,262,287 (GRCm39)	E148K	probably damaging	Het
Bckdk	C	A	7: 127,504,590 (GRCm39)	R105S	probably damaging	Het
Bhlhe22	G	T	3: 18,109,058 (GRCm39)	R36L	probably damaging	Het
Cacnb2	A	G	2: 14,609,314 (GRCm39)	E18G	probably benign	Het
Cct2	G	A	10: 116,890,040 (GRCm39)	P10L	probably damaging	Het
Cep295	G	T	9: 15,228,363 (GRCm39)		probably benign	Het
Cep89	A	G	7: 35,137,808 (GRCm39)	R731G	probably damaging	Het
Chrnb3	C	T	8: 27,884,034 (GRCm39)	T257M	probably damaging	Het
Clca3a1	T	A	3: 144,461,070 (GRCm39)	T194S	probably benign	Het
Clca4b	T	C	3: 144,631,797 (GRCm39)	K236R	probably benign	Het
Col18a1	C	A	10: 76,924,721 (GRCm39)	D23Y	probably damaging	Het
Cry1	A	T	10: 84,982,456 (GRCm39)	Y297N	probably damaging	Het
Defb38	A	G	8: 19,076,483 (GRCm39)		probably null	Het
Dlgap1	A	G	17: 70,823,780 (GRCm39)	K255R	probably damaging	Het
Erich6	T	C	3: 58,544,125 (GRCm39)	E154G	probably benign	Het
Esf1	G	A	2: 140,000,476 (GRCm39)	P437S	probably benign	Het
Fkbp7	A	C	2: 76,493,601 (GRCm39)	N197K	probably damaging	Het
Fsip2	T	A	2: 82,789,006 (GRCm39)	D342E	probably benign	Het
Gbx1	T	C	5: 24,731,213 (GRCm39)	D201G	probably benign	Het
Gm15056	T	A	8: 21,390,957 (GRCm39)	K25N	possibly damaging	Het
Grb7	T	G	11: 98,345,391 (GRCm39)		probably benign	Het
H2-M3	C	T	17: 37,582,021 (GRCm39)	A159V	probably damaging	Het
Hcar1	T	C	5: 124,016,683 (GRCm39)	N336S	probably benign	Het
Ift122	T	C	6: 115,890,882 (GRCm39)	V807A	probably benign	Het
Maml2	T	C	9: 13,532,364 (GRCm39)	V526A	possibly damaging	Het
Map3k20	C	T	2: 72,268,571 (GRCm39)	T526I	probably damaging	Het
Mmd2	T	C	5: 142,550,554 (GRCm39)	Y228C	probably damaging	Het
Mme	T	A	3: 63,235,485 (GRCm39)	Y178N	probably damaging	Het
Mras	T	C	9: 99,293,469 (GRCm39)	D57G	probably damaging	Het
Muc5ac	T	C	7: 141,367,512 (GRCm39)	C2274R	possibly damaging	Het
Or8j3c	T	A	2: 86,253,186 (GRCm39)	Y278F	probably damaging	Het
Palmd	T	C	3: 116,717,472 (GRCm39)	T342A	probably benign	Het
Prb1b	G	A	6: 132,289,657 (GRCm39)	P56S	unknown	Het
Rdh19	A	G	10: 127,686,017 (GRCm39)	N43S	probably benign	Het
Ros1	G	A	10: 51,996,974 (GRCm39)	H1233Y	possibly damaging	Het
Samd8	A	G	14: 21,830,248 (GRCm39)	R225G	probably null	Het
Slc7a11	C	A	3: 50,382,223 (GRCm39)	V175L	probably benign	Het
Spata31d1c	A	G	13: 65,182,925 (GRCm39)	T156A	possibly damaging	Het
Spata31g1	C	T	4: 42,971,534 (GRCm39)	T289I	probably damaging	Het
Spmip9	T	C	6: 70,890,283 (GRCm39)	N170D	possibly damaging	Het
Stxbp5	T	C	10: 9,665,060 (GRCm39)		probably benign	Het
Tec	T	A	5: 72,980,942 (GRCm39)		probably benign	Het
Vps16	T	C	2: 130,284,514 (GRCm39)	W728R	possibly damaging	Het
Xirp1	T	C	9: 119,846,810 (GRCm39)	E691G	probably damaging	Het
Zfp605	T	C	5: 110,275,604 (GRCm39)	S241P	probably damaging	Het
Zfp839	G	A	12: 110,832,765 (GRCm39)	G561D	probably damaging	Het

Other mutations in Mfap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Mfap2	APN	4	140,742,856 (GRCm39)	missense	possibly damaging	0.82
IGL02422:Mfap2	APN	4	140,741,535 (GRCm39)	missense	probably benign	0.02
R0149:Mfap2	UTSW	4	140,742,294 (GRCm39)	missense	probably damaging	1.00
R0361:Mfap2	UTSW	4	140,742,294 (GRCm39)	missense	probably damaging	1.00
R0545:Mfap2	UTSW	4	140,741,496 (GRCm39)	unclassified	probably benign
R3983:Mfap2	UTSW	4	140,741,554 (GRCm39)	missense	possibly damaging	0.80
R4993:Mfap2	UTSW	4	140,742,889 (GRCm39)	makesense	probably null
R5019:Mfap2	UTSW	4	140,742,569 (GRCm39)	missense	probably damaging	1.00
R8026:Mfap2	UTSW	4	140,741,114 (GRCm39)	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CGCAGACTACTATGACTACCAAGG -3'
(R):5'- TTTCTCCAGCTTACCAAGAGGG -3'

Sequencing Primer
(F):5'- CTATGACTACCAAGGTAAAAGTCTGG -3'
(R):5'- TAGGCTCAGTCTCCAGGTC -3'

Posted On

2015-10-08