Incidental Mutation 'R3981:Gbx1'
ID351159
Institutional Source Beutler Lab
Gene Symbol Gbx1
Ensembl Gene ENSMUSG00000067724
Gene Namegastrulation brain homeobox 1
SynonymsGbx-1
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3981 (G1)
Quality Score93
Status Validated
Chromosome5
Chromosomal Location24502757-24527202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24526215 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000085651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088311]
Predicted Effect probably benign
Transcript: ENSMUST00000088311
AA Change: D201G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085651
Gene: ENSMUSG00000067724
AA Change: D201G

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 113 136 N/A INTRINSIC
low complexity region 181 191 N/A INTRINSIC
low complexity region 257 296 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
HOX 316 378 3.54e-27 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles exhibit abnormal locomotor behavior affecting hindlimbs and neuron abnormalities. Neuronal abnormalities have been reported in some mice for motor neurons and GABAergic neurons and for proprioceptive sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Gbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Gbx1 APN 5 24504876 missense probably damaging 1.00
IGL03000:Gbx1 APN 5 24504926 missense probably benign 0.09
R2135:Gbx1 UTSW 5 24526222 missense possibly damaging 0.59
R3619:Gbx1 UTSW 5 24526113 missense probably benign 0.01
R4817:Gbx1 UTSW 5 24526206 missense probably damaging 0.99
R4896:Gbx1 UTSW 5 24504839 missense probably damaging 1.00
R5004:Gbx1 UTSW 5 24504839 missense probably damaging 1.00
R5422:Gbx1 UTSW 5 24504669 missense possibly damaging 0.90
R6431:Gbx1 UTSW 5 24504918 missense probably benign 0.09
R7080:Gbx1 UTSW 5 24526300 missense probably benign 0.00
R7811:Gbx1 UTSW 5 24505037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGAACACCGCGTACGATC -3'
(R):5'- TGAGCAATACCTTCTGCGCG -3'

Sequencing Primer
(F):5'- AACACCGCGTACGATCTGGAG -3'
(R):5'- ATGGTGGCGCTGACCACTGC -3'
Posted On2015-10-08