Incidental Mutation 'R3981:Zfp605'
ID351161
Institutional Source Beutler Lab
Gene Symbol Zfp605
Ensembl Gene ENSMUSG00000023284
Gene Namezinc finger protein 605
Synonyms
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110110092-110129794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110127738 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000108147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086686] [ENSMUST00000112528] [ENSMUST00000147631]
Predicted Effect probably damaging
Transcript: ENSMUST00000086686
AA Change: S241P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083891
Gene: ENSMUSG00000023284
AA Change: S241P

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112528
AA Change: S241P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108147
Gene: ENSMUSG00000023284
AA Change: S241P

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
low complexity region 147 159 N/A INTRINSIC
ZnF_C2H2 200 222 1.36e-2 SMART
ZnF_C2H2 228 250 4.38e1 SMART
ZnF_C2H2 305 327 1.18e-2 SMART
ZnF_C2H2 333 355 5.14e-3 SMART
ZnF_C2H2 361 383 9.73e-4 SMART
ZnF_C2H2 389 411 4.99e1 SMART
ZnF_C2H2 443 465 5.4e1 SMART
ZnF_C2H2 471 493 1.3e-4 SMART
ZnF_C2H2 499 521 4.24e-4 SMART
ZnF_C2H2 527 549 1.95e-3 SMART
ZnF_C2H2 555 577 2.09e-3 SMART
ZnF_C2H2 583 605 1.2e-3 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.53e-2 SMART
ZnF_C2H2 667 689 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144089
Predicted Effect probably benign
Transcript: ENSMUST00000147631
SMART Domains Protein: ENSMUSP00000122236
Gene: ENSMUSG00000023284

DomainStartEndE-ValueType
KRAB 6 66 3.75e-28 SMART
Meta Mutation Damage Score 0.7958 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Zfp605
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02388:Zfp605 APN 5 110127640 missense possibly damaging 0.95
R0010:Zfp605 UTSW 5 110127534 missense probably benign 0.03
R0357:Zfp605 UTSW 5 110124379 missense probably benign
R0383:Zfp605 UTSW 5 110128854 missense probably damaging 1.00
R1017:Zfp605 UTSW 5 110127994 missense probably benign 0.42
R1663:Zfp605 UTSW 5 110127585 missense probably benign 0.02
R1688:Zfp605 UTSW 5 110129041 missense possibly damaging 0.83
R1752:Zfp605 UTSW 5 110123773 missense probably damaging 1.00
R1994:Zfp605 UTSW 5 110127552 missense probably damaging 1.00
R2173:Zfp605 UTSW 5 110127457 missense probably benign 0.00
R3740:Zfp605 UTSW 5 110128698 missense probably damaging 1.00
R3742:Zfp605 UTSW 5 110128698 missense probably damaging 1.00
R4095:Zfp605 UTSW 5 110127736 missense probably damaging 1.00
R4349:Zfp605 UTSW 5 110128686 missense probably damaging 1.00
R4669:Zfp605 UTSW 5 110127361 missense possibly damaging 0.94
R4914:Zfp605 UTSW 5 110127701 nonsense probably null
R4994:Zfp605 UTSW 5 110127486 missense probably damaging 1.00
R6672:Zfp605 UTSW 5 110127997 missense probably damaging 1.00
R6814:Zfp605 UTSW 5 110127445 missense probably benign 0.00
R6872:Zfp605 UTSW 5 110127445 missense probably benign 0.00
R7251:Zfp605 UTSW 5 110127960 missense probably damaging 1.00
R7395:Zfp605 UTSW 5 110112019 start gained probably benign
R7560:Zfp605 UTSW 5 110127291 nonsense probably null
R7623:Zfp605 UTSW 5 110127520 missense probably benign 0.03
R7999:Zfp605 UTSW 5 110128434 missense probably damaging 1.00
X0063:Zfp605 UTSW 5 110123848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTAATGAGTCACAGCTCG -3'
(R):5'- GACTTCTTCAAAGCCATAACATTTC -3'

Sequencing Primer
(F):5'- TGAGTCACAGCTCGTTACAAAG -3'
(R):5'- CTAATGAGAAGCGAGTTCCTCCTG -3'
Posted On2015-10-08