Mutagenetix > Incidental Mutations

Incidental Mutation 'R3981:Alkbh2'

351162

Institutional Source

Beutler Lab

Gene Symbol

Alkbh2

Ensembl Gene

ENSMUSG00000044339

Gene Name

alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase

Synonyms

Abh2, mABH2

MMRRC Submission

040943-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3981 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114123926-114128218 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 114124226 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 148 (E148K)

Ref Sequence

ENSEMBL: ENSMUSP00000107898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]

Predicted Effect

probably benign
Transcript: ENSMUST00000031588

SMART Domains

Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
transmembrane domain	35	57	N/A	INTRINSIC
Pfam:UCH	67	499	2.6e-44	PFAM
Pfam:UCH_1	68	481	8.8e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:2OG-FeII_Oxy_2	47	232	1.9e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:2OG-FeII_Oxy_2	47	232	5.4e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149418

Predicted Effect

probably benign
Transcript: ENSMUST00000200119

SMART Domains

Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
transmembrane domain	35	57	N/A	INTRINSIC
Pfam:UCH	67	368	2.9e-31	PFAM
Pfam:UCH_1	68	376	1e-14	PFAM

Meta Mutation Damage Score

0.2232

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	T	4: 42,971,534	T289I	probably damaging	Het
Abca13	T	G	11: 9,532,407	C4313G	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bhlhe22	G	T	3: 18,054,894	R36L	probably damaging	Het
Cacnb2	A	G	2: 14,604,503	E18G	probably benign	Het
Cct2	G	A	10: 117,054,135	P10L	probably damaging	Het
Cep295	G	T	9: 15,317,067		probably benign	Het
Cep89	A	G	7: 35,438,383	R731G	probably damaging	Het
Chrnb3	C	T	8: 27,394,006	T257M	probably damaging	Het
Clca3a1	T	A	3: 144,755,309	T194S	probably benign	Het
Clca4b	T	C	3: 144,926,036	K236R	probably benign	Het
Col18a1	C	A	10: 77,088,887	D23Y	probably damaging	Het
Cry1	A	T	10: 85,146,592	Y297N	probably damaging	Het
Defb38	A	G	8: 19,026,467		probably null	Het
Dlgap1	A	G	17: 70,516,785	K255R	probably damaging	Het
Erich6	T	C	3: 58,636,704	E154G	probably benign	Het
Esf1	G	A	2: 140,158,556	P437S	probably benign	Het
Fkbp7	A	C	2: 76,663,257	N197K	probably damaging	Het
Fsip2	T	A	2: 82,958,662	D342E	probably benign	Het
Gbx1	T	C	5: 24,526,215	D201G	probably benign	Het
Gm15056	T	A	8: 20,900,941	K25N	possibly damaging	Het
Grb7	T	G	11: 98,454,565		probably benign	Het
H2-M3	C	T	17: 37,271,130	A159V	probably damaging	Het
Hcar1	T	C	5: 123,878,620	N336S	probably benign	Het
Ift122	T	C	6: 115,913,921	V807A	probably benign	Het
Maml2	T	C	9: 13,621,068	V526A	possibly damaging	Het
Map3k20	C	T	2: 72,438,227	T526I	probably damaging	Het
Mfap2	A	G	4: 141,014,243	Q71R	possibly damaging	Het
Mmd2	T	C	5: 142,564,799	Y228C	probably damaging	Het
Mme	T	A	3: 63,328,064	Y178N	probably damaging	Het
Mras	T	C	9: 99,411,416	D57G	probably damaging	Het
Muc5ac	T	C	7: 141,813,775	C2274R	possibly damaging	Het
Olfr1062	T	A	2: 86,422,842	Y278F	probably damaging	Het
Palmd	T	C	3: 116,923,823	T342A	probably benign	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rdh19	A	G	10: 127,850,148	N43S	probably benign	Het
Ros1	G	A	10: 52,120,878	H1233Y	possibly damaging	Het
Samd8	A	G	14: 21,780,180	R225G	probably null	Het
Slc7a11	C	A	3: 50,427,774	V175L	probably benign	Het
Spata31d1c	A	G	13: 65,035,111	T156A	possibly damaging	Het
Stxbp5	T	C	10: 9,789,316		probably benign	Het
Tec	T	A	5: 72,823,599		probably benign	Het
Tex37	T	C	6: 70,913,299	N170D	possibly damaging	Het
Vps16	T	C	2: 130,442,594	W728R	possibly damaging	Het
Xirp1	T	C	9: 120,017,744	E691G	probably damaging	Het
Zfp605	T	C	5: 110,127,738	S241P	probably damaging	Het
Zfp839	G	A	12: 110,866,331	G561D	probably damaging	Het

Other mutations in Alkbh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02298:Alkbh2	APN	5	114125572	missense	probably benign
R0326:Alkbh2	UTSW	5	114123950	makesense	probably null
R0480:Alkbh2	UTSW	5	114125535	missense	probably damaging	1.00
R0962:Alkbh2	UTSW	5	114123953	missense	possibly damaging	0.94
R1214:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1215:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1280:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1282:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1309:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1340:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1371:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1443:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1445:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1545:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1546:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1629:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1631:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1632:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1707:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1769:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1920:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1921:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1922:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R1984:Alkbh2	UTSW	5	114124054	missense	probably benign	0.12
R2140:Alkbh2	UTSW	5	114125716	missense	probably benign	0.03
R2142:Alkbh2	UTSW	5	114125716	missense	probably benign	0.03
R3800:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4032:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4062:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4064:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4163:Alkbh2	UTSW	5	114127552	missense	probably damaging	1.00
R4569:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4570:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4624:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4625:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4626:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4627:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4628:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4630:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4632:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4633:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4801:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4802:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98
R4803:Alkbh2	UTSW	5	114124226	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCATCATCAGCAGGCTTCCG -3'
(R):5'- GGCCTGCAGGTATTGTAAGAAGC -3'

Sequencing Primer
(F):5'- AGCAGGCTTCCGTGTGC -3'
(R):5'- CCCAAATAGTTCTACTAGCTGGGG -3'

Posted On

2015-10-08