Incidental Mutation 'R3981:Prpmp5'
ID351167
Institutional Source Beutler Lab
Gene Symbol Prpmp5
Ensembl Gene ENSMUSG00000107874
Gene Nameproline-rich protein MP5
SynonymsMP5
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132311590-132314757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132312694 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 56 (P56S)
Ref Sequence ENSEMBL: ENSMUSP00000047347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048686]
Predicted Effect unknown
Transcript: ENSMUST00000048686
AA Change: P56S
SMART Domains Protein: ENSMUSP00000047347
Gene: ENSMUSG00000107874
AA Change: P56S

DomainStartEndE-ValueType
Pfam:Pro-rich 1 136 2.2e-36 PFAM
Pfam:Pro-rich 84 169 6.1e-17 PFAM
Pfam:Pro-rich 131 182 2.5e-10 PFAM
Pfam:Pro-rich 171 228 4.7e-10 PFAM
Pfam:Pro-rich 222 290 1.1e-11 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Prpmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Prpmp5 APN 6 132312420 missense unknown
IGL02259:Prpmp5 APN 6 132312674 missense unknown
IGL02434:Prpmp5 APN 6 132312376 missense unknown
IGL03238:Prpmp5 APN 6 132312345 missense unknown
R0971:Prpmp5 UTSW 6 132313655 missense unknown
R1900:Prpmp5 UTSW 6 132314698 missense unknown
R3800:Prpmp5 UTSW 6 132312694 missense unknown
R3951:Prpmp5 UTSW 6 132312694 missense unknown
R3952:Prpmp5 UTSW 6 132312694 missense unknown
R4083:Prpmp5 UTSW 6 132312694 missense unknown
R4348:Prpmp5 UTSW 6 132313661 missense unknown
R4351:Prpmp5 UTSW 6 132313661 missense unknown
R4352:Prpmp5 UTSW 6 132313661 missense unknown
R4353:Prpmp5 UTSW 6 132313661 missense unknown
R6190:Prpmp5 UTSW 6 132312729 missense unknown
R7001:Prpmp5 UTSW 6 132312564 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGTTTCCAGGCCTAAGGG -3'
(R):5'- TTTGCACAGCATTTAAGGACG -3'

Sequencing Primer
(F):5'- TAAGGGGACTCTGTGGGCC -3'
(R):5'- TGCACAGCATTTAAGGACGAATACTC -3'
Posted On2015-10-08