Incidental Mutation 'R3981:Mras'
ID351176
Institutional Source Beutler Lab
Gene Symbol Mras
Ensembl Gene ENSMUSG00000032470
Gene Namemuscle and microspikes RAS
Synonyms2900078C09Rik
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99385420-99437381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99411416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 57 (D57G)
Ref Sequence ENSEMBL: ENSMUSP00000121307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035045] [ENSMUST00000119472] [ENSMUST00000122384] [ENSMUST00000123771]
Predicted Effect probably damaging
Transcript: ENSMUST00000035045
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035045
Gene: ENSMUSG00000032470
AA Change: D57G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119472
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112407
Gene: ENSMUSG00000032470
AA Change: D57G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122384
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113275
Gene: ENSMUSG00000032470
AA Change: D57G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123771
AA Change: D57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121307
Gene: ENSMUSG00000032470
AA Change: D57G

DomainStartEndE-ValueType
RAS 11 130 1.06e-68 SMART
Meta Mutation Damage Score 0.7221 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit a decreased mean percentage of peripheral blood B cells but no other evidence of morphological or neurological defects; mutant astrocytes display normal responsiveness to different trophic factors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Mras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Mras APN 9 99411495 missense probably damaging 1.00
R3918:Mras UTSW 9 99411420 missense probably damaging 1.00
R3919:Mras UTSW 9 99411420 missense probably damaging 1.00
R4950:Mras UTSW 9 99394484 missense probably damaging 1.00
R5375:Mras UTSW 9 99394616 missense probably damaging 1.00
R5501:Mras UTSW 9 99411546 missense probably damaging 1.00
R5624:Mras UTSW 9 99411485 missense probably damaging 0.99
R6349:Mras UTSW 9 99394616 missense probably damaging 1.00
R6350:Mras UTSW 9 99411507 missense probably damaging 1.00
R7453:Mras UTSW 9 99389740 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTTTCGTTGCCACTAAG -3'
(R):5'- TGACTACCAGAAACATGGCGAC -3'

Sequencing Primer
(F):5'- CGTTGCCACTAAGATCATTAAGCAG -3'
(R):5'- ACCAGCGCTGTTCCAAGTG -3'
Posted On2015-10-08