Incidental Mutation 'R3981:Cct2'
ID351183
Institutional Source Beutler Lab
Gene Symbol Cct2
Ensembl Gene ENSMUSG00000034024
Gene Namechaperonin containing Tcp1, subunit 2 (beta)
SynonymsCctb
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117051001-117063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117054135 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047672]
Predicted Effect probably damaging
Transcript: ENSMUST00000047672
AA Change: P447L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036288
Gene: ENSMUSG00000034024
AA Change: P447L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 35 525 3.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218502
Predicted Effect probably damaging
Transcript: ENSMUST00000219690
AA Change: P10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Cct2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Cct2 APN 10 117053112 missense probably damaging 0.99
IGL02150:Cct2 APN 10 117062099 missense probably damaging 0.99
IGL02349:Cct2 APN 10 117053139 missense probably benign 0.04
IGL03010:Cct2 APN 10 117058114 missense probably damaging 1.00
IGL03155:Cct2 APN 10 117060671 missense probably damaging 0.99
R0507:Cct2 UTSW 10 117055246 splice site probably null
R0742:Cct2 UTSW 10 117055246 splice site probably null
R1102:Cct2 UTSW 10 117060640 unclassified probably null
R1438:Cct2 UTSW 10 117054992 unclassified probably benign
R2040:Cct2 UTSW 10 117053113 missense probably benign 0.00
R2157:Cct2 UTSW 10 117062809 splice site probably benign
R2227:Cct2 UTSW 10 117053017 missense probably null 0.18
R3410:Cct2 UTSW 10 117062063 missense probably benign 0.01
R3983:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R4364:Cct2 UTSW 10 117055151 missense probably damaging 1.00
R4401:Cct2 UTSW 10 117057809 missense possibly damaging 0.61
R6162:Cct2 UTSW 10 117058186 missense probably damaging 0.99
R6300:Cct2 UTSW 10 117056159 missense probably damaging 0.96
R6312:Cct2 UTSW 10 117056055 missense probably benign 0.00
R7075:Cct2 UTSW 10 117061465 missense unknown
R7198:Cct2 UTSW 10 117053124 missense probably benign
R7236:Cct2 UTSW 10 117061559 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTGCGTGTCCATACAGAC -3'
(R):5'- GTCCTTGGTGGTTATTCATCAC -3'

Sequencing Primer
(F):5'- TGTCCATACAGACATACAAAGTGG -3'
(R):5'- AATAGAGTTTATTCTGGGCATAGGG -3'
Posted On2015-10-08