Incidental Mutation 'R4650:Dis3l2'
ID 351193
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene Name DIS3 like 3'-5' exoribonuclease 2
Synonyms 4930429A22Rik, 8030493P09Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R4650 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 86703808-87050095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86990321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 550 (D550G)
Ref Sequence ENSEMBL: ENSMUSP00000070506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
AlphaFold Q8CI75
PDB Structure Structure of mouse Dis3L2 in complex with oligoU RNA substrate [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065694
AA Change: D550G

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: D550G

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: D564G

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: D564G

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185304
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195266
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4547:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4548:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86760321 missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86857341 missense probably benign
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
R8422:Dis3l2 UTSW 1 86854377 missense probably benign
R8696:Dis3l2 UTSW 1 86791440 nonsense probably null
R9235:Dis3l2 UTSW 1 86821339 missense possibly damaging 0.95
R9291:Dis3l2 UTSW 1 86973493 missense possibly damaging 0.82
R9629:Dis3l2 UTSW 1 87047062 missense probably benign 0.00
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCGTTCTTGCACCAAACTGAG -3'
(R):5'- CAGGTTTTCCAGGTAAGAGCAG -3'

Sequencing Primer
(F):5'- GTTCTTGCACCAAACTGAGCTACG -3'
(R):5'- CAGCTGGGAGTCACAGAACTC -3'
Posted On 2015-10-08