Mutagenetix > Incidental Mutation

Incidental Mutation 'R4650:Lamc1'

351196

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4650 (G1)

Quality Score

203

Status

Not validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 153228777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 59 (S59R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027752
AA Change: S1356R

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: S1356R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160515

Predicted Effect

probably damaging
Transcript: ENSMUST00000161744
AA Change: S59R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124662
Gene: ENSMUSG00000026478
AA Change: S59R

Domain	Start	End	E-Value	Type
coiled coil region	1	73	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163011

SMART Domains

Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	T	A	16: 89,063,715	Y77F	unknown	Het
4933409G03Rik	G	A	2: 68,606,215	E168K	unknown	Het
Aldoa	A	G	7: 126,797,707	S71P	possibly damaging	Het
Arhgef12	A	G	9: 42,981,970	V979A	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Brd8	T	C	18: 34,606,699	T674A	probably benign	Het
Cacna1d	C	T	14: 30,095,408	M1232I	probably benign	Het
Capza1	A	G	3: 104,844,980	V14A	probably damaging	Het
Cdk2	A	T	10: 128,702,495	I135N	probably damaging	Het
Celf4	A	T	18: 25,496,245	M407K	possibly damaging	Het
Cenpf	A	T	1: 189,660,038	D532E	probably benign	Het
Cideb	A	G	14: 55,755,231	V76A	possibly damaging	Het
Dbpht2	C	G	12: 74,299,159		noncoding transcript	Het
Dis3l2	A	G	1: 86,990,321	D550G	possibly damaging	Het
Dnah1	A	T	14: 31,284,887		probably null	Het
Edc4	T	A	8: 105,892,675	L1293*	probably null	Het
Elp5	A	G	11: 69,969,572	V203A	possibly damaging	Het
Fndc7	T	C	3: 108,862,819	N597S	probably benign	Het
Gjb3	T	C	4: 127,326,691	Y16C	probably damaging	Het
Gm5773	A	G	3: 93,773,405	D128G	probably benign	Het
Gnb1l	T	C	16: 18,544,275		probably null	Het
Gon4l	G	A	3: 88,863,552	D514N	possibly damaging	Het
Grhl3	T	A	4: 135,549,236		probably null	Het
Hoxc10	T	C	15: 102,967,263	S136P	probably benign	Het
Ift22	G	A	5: 136,911,801	V107I	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lgi4	G	A	7: 31,069,129	A518T	probably benign	Het
Lhx2	T	A	2: 38,360,040	N290K	probably damaging	Het
Ltbp4	A	T	7: 27,314,309	C1092S	probably damaging	Het
Macf1	T	C	4: 123,473,619	I2450V	probably benign	Het
Mefv	A	G	16: 3,717,818	L82P	probably damaging	Het
Myb	A	G	10: 21,152,941	L86P	probably damaging	Het
Myh3	C	T	11: 67,086,444	T333M	probably damaging	Het
Nek11	T	C	9: 105,348,080	N78D	possibly damaging	Het
Nmi	C	A	2: 51,948,634	C296F	probably benign	Het
Nphs1	A	T	7: 30,482,470	T1163S	probably benign	Het
Npy4r	C	T	14: 34,146,224	G369D	possibly damaging	Het
Ola1	T	C	2: 73,141,965	T221A	probably damaging	Het
Olfr251	T	C	9: 38,378,403	F168S	probably damaging	Het
Olfr557	A	G	7: 102,698,820	D194G	probably damaging	Het
Pfkfb2	A	T	1: 130,705,463	N184K	possibly damaging	Het
Plce1	T	C	19: 38,524,644	V129A	probably benign	Het
Prps2	T	C	X: 167,352,292	D183G	probably damaging	Het
Pth	A	T	7: 113,385,819	*116K	probably null	Het
R3hdm1	T	C	1: 128,184,444	S422P	probably damaging	Het
Rhox2a	G	C	X: 37,245,309	R43P	probably benign	Het
Rwdd3	A	G	3: 121,159,177	F55S	probably damaging	Het
Serpinb9d	A	T	13: 33,202,853	L301F	probably benign	Het
Slc35e4	A	G	11: 3,912,677	C171R	probably damaging	Het
Slco1a4	A	T	6: 141,812,698	I529K	possibly damaging	Het
Styk1	A	T	6: 131,300,569	W370R	probably damaging	Het
Tmprss11e	C	A	5: 86,727,353	W18L	probably damaging	Het
Trpv1	A	C	11: 73,238,263	E2A	probably benign	Het
Unc13b	T	A	4: 43,261,035	I1799N	probably damaging	Het
Vmn1r213	G	A	13: 23,012,252	C335Y	possibly damaging	Het
Vps37c	C	T	19: 10,712,909	S245L	probably benign	Het
Wrn	T	C	8: 33,255,509	T1191A	probably benign	Het
Zfp13	A	G	17: 23,580,138	L153P	probably damaging	Het
Zfp472	T	G	17: 32,977,657	S235R	possibly damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCACTGCATCTAAATAGTCTATGGG -3'
(R):5'- TTAAACTGCTCAGGTGGGAG -3'

Sequencing Primer
(F):5'- GGGAATTACCATACTCTTTCGTTCTG -3'
(R):5'- AGCCTAGCGTGTCTAGCG -3'

Posted On

2015-10-08