Incidental Mutation 'R4650:Lhx2'
ID 351198
Institutional Source Beutler Lab
Gene Symbol Lhx2
Ensembl Gene ENSMUSG00000000247
Gene Name LIM homeobox protein 2
Synonyms LH2A, ap, apterous, Lh-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4650 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 38229293-38259745 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38250052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 290 (N290K)
Ref Sequence ENSEMBL: ENSMUSP00000000253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000253] [ENSMUST00000143783]
AlphaFold Q9Z0S2
Predicted Effect probably damaging
Transcript: ENSMUST00000000253
AA Change: N290K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000253
Gene: ENSMUSG00000000247
AA Change: N290K

DomainStartEndE-ValueType
LIM 52 105 6e-18 SMART
LIM 114 168 1.18e-16 SMART
low complexity region 187 206 N/A INTRINSIC
HOX 266 328 8.07e-22 SMART
low complexity region 357 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137134
Predicted Effect probably damaging
Transcript: ENSMUST00000143783
AA Change: N249K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114797
Gene: ENSMUSG00000000247
AA Change: N249K

DomainStartEndE-ValueType
LIM 11 64 6e-18 SMART
LIM 73 127 1.18e-16 SMART
low complexity region 146 165 N/A INTRINSIC
HOX 225 287 8.07e-22 SMART
low complexity region 316 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175896
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator. The protein can recapitulate or rescue phenotypes in Drosophila caused by a related protein, suggesting conservation of function during evolution. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during fetal development and the perinatal period with abnormal liver, telencephalon, olfactory bulb, basal ganglion, and eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 88,860,603 (GRCm39) Y77F unknown Het
4933409G03Rik G A 2: 68,436,559 (GRCm39) E168K unknown Het
Aldoa A G 7: 126,396,879 (GRCm39) S71P possibly damaging Het
Arhgef12 A G 9: 42,893,266 (GRCm39) V979A probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Brd8 T C 18: 34,739,752 (GRCm39) T674A probably benign Het
Cacna1d C T 14: 29,817,365 (GRCm39) M1232I probably benign Het
Capza1 A G 3: 104,752,296 (GRCm39) V14A probably damaging Het
Cdk2 A T 10: 128,538,364 (GRCm39) I135N probably damaging Het
Celf4 A T 18: 25,629,302 (GRCm39) M407K possibly damaging Het
Cenpf A T 1: 189,392,235 (GRCm39) D532E probably benign Het
Cideb A G 14: 55,992,688 (GRCm39) V76A possibly damaging Het
Dbpht2 C G 12: 74,345,933 (GRCm39) noncoding transcript Het
Dis3l2 A G 1: 86,918,043 (GRCm39) D550G possibly damaging Het
Dnah1 A T 14: 31,006,844 (GRCm39) probably null Het
Edc4 T A 8: 106,619,307 (GRCm39) L1293* probably null Het
Elp5 A G 11: 69,860,398 (GRCm39) V203A possibly damaging Het
Fndc7 T C 3: 108,770,135 (GRCm39) N597S probably benign Het
Gjb3 T C 4: 127,220,484 (GRCm39) Y16C probably damaging Het
Gm5773 A G 3: 93,680,712 (GRCm39) D128G probably benign Het
Gnb1l T C 16: 18,363,025 (GRCm39) probably null Het
Gon4l G A 3: 88,770,859 (GRCm39) D514N possibly damaging Het
Grhl3 T A 4: 135,276,547 (GRCm39) probably null Het
Hoxc10 T C 15: 102,875,698 (GRCm39) S136P probably benign Het
Ift22 G A 5: 136,940,655 (GRCm39) V107I probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lamc1 T G 1: 153,104,523 (GRCm39) S59R probably damaging Het
Lgi4 G A 7: 30,768,554 (GRCm39) A518T probably benign Het
Ltbp4 A T 7: 27,013,734 (GRCm39) C1092S probably damaging Het
Macf1 T C 4: 123,367,412 (GRCm39) I2450V probably benign Het
Mefv A G 16: 3,535,682 (GRCm39) L82P probably damaging Het
Myb A G 10: 21,028,840 (GRCm39) L86P probably damaging Het
Myh3 C T 11: 66,977,270 (GRCm39) T333M probably damaging Het
Nek11 T C 9: 105,225,279 (GRCm39) N78D possibly damaging Het
Nmi C A 2: 51,838,646 (GRCm39) C296F probably benign Het
Nphs1 A T 7: 30,181,895 (GRCm39) T1163S probably benign Het
Npy4r C T 14: 33,868,181 (GRCm39) G369D possibly damaging Het
Ola1 T C 2: 72,972,309 (GRCm39) T221A probably damaging Het
Or51d1 A G 7: 102,348,027 (GRCm39) D194G probably damaging Het
Or8c11 T C 9: 38,289,699 (GRCm39) F168S probably damaging Het
Pfkfb2 A T 1: 130,633,200 (GRCm39) N184K possibly damaging Het
Plce1 T C 19: 38,513,088 (GRCm39) V129A probably benign Het
Prps2 T C X: 166,135,288 (GRCm39) D183G probably damaging Het
Pth A T 7: 112,985,026 (GRCm39) *116K probably null Het
R3hdm1 T C 1: 128,112,181 (GRCm39) S422P probably damaging Het
Rhox2a G C X: 36,508,962 (GRCm39) R43P probably benign Het
Rwdd3 A G 3: 120,952,826 (GRCm39) F55S probably damaging Het
Serpinb9d A T 13: 33,386,836 (GRCm39) L301F probably benign Het
Slc35e4 A G 11: 3,862,677 (GRCm39) C171R probably damaging Het
Slco1a4 A T 6: 141,758,424 (GRCm39) I529K possibly damaging Het
Styk1 A T 6: 131,277,532 (GRCm39) W370R probably damaging Het
Tmprss11e C A 5: 86,875,212 (GRCm39) W18L probably damaging Het
Trpv1 A C 11: 73,129,089 (GRCm39) E2A probably benign Het
Unc13b T A 4: 43,261,035 (GRCm39) I1799N probably damaging Het
Vmn1r213 G A 13: 23,196,422 (GRCm39) C335Y possibly damaging Het
Vps37c C T 19: 10,690,273 (GRCm39) S245L probably benign Het
Wrn T C 8: 33,745,537 (GRCm39) T1191A probably benign Het
Zfp13 A G 17: 23,799,112 (GRCm39) L153P probably damaging Het
Zfp472 T G 17: 33,196,631 (GRCm39) S235R possibly damaging Het
Other mutations in Lhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02087:Lhx2 APN 2 38,258,849 (GRCm39) splice site probably benign
IGL02243:Lhx2 APN 2 38,243,531 (GRCm39) splice site probably benign
IGL02250:Lhx2 APN 2 38,244,845 (GRCm39) missense probably benign 0.00
IGL03306:Lhx2 APN 2 38,244,628 (GRCm39) missense probably damaging 1.00
R3700:Lhx2 UTSW 2 38,250,111 (GRCm39) missense probably damaging 1.00
R3795:Lhx2 UTSW 2 38,243,359 (GRCm39) missense probably damaging 1.00
R4732:Lhx2 UTSW 2 38,250,003 (GRCm39) missense probably damaging 1.00
R4733:Lhx2 UTSW 2 38,250,003 (GRCm39) missense probably damaging 1.00
R5853:Lhx2 UTSW 2 38,259,053 (GRCm39) missense probably damaging 0.99
R7463:Lhx2 UTSW 2 38,241,858 (GRCm39) missense possibly damaging 0.55
R9089:Lhx2 UTSW 2 38,250,045 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGCAGAGTCAGGAAATTC -3'
(R):5'- AGGCTGACATTCTAAGACAAACTAC -3'

Sequencing Primer
(F):5'- AGGAAATTCACCTGCTGCTTCTG -3'
(R):5'- GACATTCTAAGACAAACTACAAAGGG -3'
Posted On 2015-10-08